Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CGCAGGACCAGTTTCCATAGACTGCGGACTGGGGTCTTCCTCCAGCAGTTACTTGATGCCCCCTCCCCCGACACAGACTCTCAATCTGCCGGTGGTAAGAACCGGTTCTGAGCTGGCGTCTGAGCTGCTGCGGGGTGGAAGTGGGGGGCTGCCCACTCCACTCCTCCCATCCCCTCCCAGCCTCCTCCTCCGGCAGGAACTGAACAGAACCACAAAAAGTCTACATTTATTTAATATGATGGTCTTTGCAAAAAGGAACAAAACAACACAAAAGCCCACCAGGCTGCTGCTTTGTGGAAAGACGGTGTGTGTCGTGTGAAGGCGAAACCCGGTGTACATAACCCCTCCCCCTCCGCCCCGCCCCGCCCGGCCCCGTAGAGTCCCTGTCGCCCGCCGGCCCTGCCTGTAGATACGCCCCGCTGTCTGTGCTGTGAGAGTCGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PAX2(5076)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yuji Atsuta et al.
Development (Cambridge, England), 143(19), 3549-3559 (2016-09-01)
The Müllerian duct (MD) and Wolffian duct (WD) are embryonic tubular tissues giving rise to female and male reproductive tracts, respectively. In amniote embryos, both MD and WD emerge in both sexes, but subsequently degenerate in the males and females
Imlimaong Aier et al.
PloS one, 14(10), e0223554-e0223554 (2019-10-18)
Pancreatic ductal adenocarcinoma (PDAC) is notoriously difficult to treat due to its aggressive, ever resilient nature. A major drawback lies in its tumor grade; a phenomenon observed across various carcinomas, where highly differentiated and undifferentiated tumor grades, termed as low
Huanyu Zhao et al.
Molecular carcinogenesis, 54 Suppl 1, E112-E121 (2014-08-27)
Dishevelled-3 (Dvl-3) and p120-catenin (p120ctn) have abnormal expression in non-small cell lung cancer (NSCLC), which is associated with poor prognosis. Dvl-3 upregulates p120ctn transcription in NSCLC cells, but the mechanism is unknown. Here we transiently transfected Dvl-3 cDNA to NSCLC
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU139841-50UG | 04061828413003 |
| EHU139841-20UG | 04061828637973 |