Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTCACCCGGATGAAGAACATTGAGTGCATTGAGCTGGGCCGGCACCGCCTCAAGCCGTGGTACTTCTCCCCGTACCCACAGGAACTCACCACATTGCCTGTCCTCTACCTGTGCGAGTTCTGCCTCAAGTACGGCCGTAGTCTCAAGTGTCTTCAGCGTCATTTGACCAAGTGTGACCTACGACATCCTCCAGGCAATGAGATTTACCGCAAGGGCACCATCTCCTTCTTTGAGATTGATGGACGTAAGAACAAGAGTTATTCCCAGAACCTGTGTCTTTTGGCCAAGTGTTTCCTTGACCATAAGACACTGTACTATGACACAGACCCTTTCCTCTTCTACGTCATGACAGAGTATGACTGTAAGGGCTTCCACATCGTGGGCTACTTCTCCAAGGAGAAAGAATCAACGGAAGACTACAATGTGGCCTGCATCCTAAC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... KAT5(10524)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Xueqin Wang et al.
BMC microbiology, 10, 228-228 (2010-08-28)
Salmonella enterica is a facultative intracellular pathogen that replicates within a membrane-bound compartment termed Salmonella containing vacuole (SCV). The biogenesis of SCV requires Salmonella type III protein secretion/translocation system and their effector proteins which are translocated into host cells to
Shengyuan Zeng et al.
Protein & cell, 8(3), 202-218 (2016-10-16)
UHRF2 is a ubiquitin-protein ligase E3 that regulates cell cycle, genomic stability and epigenetics. We conducted a co-immunoprecipitation assay and found that TIP60 and HDAC1 interact with UHRF2. We previously demonstrated that UHRF2 regulated H3K9ac and H3K14ac differentially in normal
Jian Li et al.
PloS one, 6(8), e23725-e23725 (2011-08-23)
GPR50 is an orphan G-protein coupled receptor most closely related to the melatonin receptors. The physiological function of GPR50 remains unclear, although our previous studies implicate the receptor in energy homeostasis. Here, we reveal a role for GPR50 as a
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU139921-50UG | 04061831375831 |
| EHU139921-20UG | 04061831365023 |