Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCGGTGCCTTCCTCTTTTTATTTAGTTCCTTGAGTTGATTCAGCTCTGCAAGAATTGAAGCAGGACTAAATGTCTAGTTGTAACACCATGATTAACCACTTCAGCTGACTTTTCTGTCCGAGCTTTGAAAATTCAGTGGTGTTAGTGGTTACCCAGTTAGCTCTCAAGTTATCAGGGTATTCCAGAGTGGGGATATGATTTAAATCAGCCGTGTAACCATGGACCCAATATTTACCAGACCACAAAACTTTTCTAATACTCTACCCTCTTAGAAAAACCACCACCATCACCAGACAGGTGCGAAAGGATGAAAGTGACCATGTTTTGTTTACGGTTTTCCAGGTTTAAGCTGTTACTGTCTTCAGTAAGCCGTGATTTTCATTGCTGGGCTTGTCTGTAGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... IL6R(3570)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Wen Deng et al.
International journal of stem cells, 13(1), 142-150 (2020-01-01)
Mesenchymal stem cells (MSCs) have the multipotent capacity to differentiate into multiple tissue lineages as well as to self-renew, which is the main origin of adipocytes. IL6/IL6R pathway exerts a significant role in tissue regeneration and cell differentiation. Whereas, the
Xusheng Ding et al.
Cell death & disease, 9(9), 867-867 (2018-08-31)
Cancer-associated fibroblasts (CAFs) are important components of tumor stroma and play a key role in tumor progression. CAFs involve in crosstalk with tumor cells through various kinds of cytokines. In the present study, we screened hepatocyte growth factor (HGF) as
Arjan J van Adrichem et al.
FEBS letters, 589(24 Pt B), 3859-3865 (2015-11-26)
Male germ cell Rac GTPase-activating protein (MgcRacGAP) is a core regulator of cytokinesis. Furthermore, it appears to be involved in human oncogenesis through cytokinesis-independent mechanisms and has been reported to be essential for nuclear translocation of signal transducer and activator
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU140561-20UG | 04061828638611 |
| EHU140561-50UG | 04061831375848 |