Skip to Content
Merck
CN

EHU142971

Sigma-Aldrich

MISSION® esiRNA

targeting human KDM3B

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGAAAGTTCGGGATTTCTGGGATGGTTTCGAGATCATATGCAAACGACTACGGTCAGAAGATGGGCAGCCAATGGTGCTCAAACTCAAGGACTGGCCTCCTGGGGAAGATTTTCGAGACATGATGCCAACCAGGTTTGAAGATCTGATGGAGAACCTTCCTCTGCCAGAATATACCAAACGAGATGGCAGGCTCAATCTGGCCTCTAGGCTACCTAGCTACTTTGTAAGGCCTGATCTGGGCCCCAAGATGTACAACGCCTATGGGTTGATAACAGCAGAAGATAGAAGAGTTGGTACAACAAATCTTCACTTAGATGTGTCTGATGCTGTTAATGTGATGGTGTATGTTGGGATTCCCATCGGGGAGGGTGCTCATGATGAAGAGGTACTCAAGACAATTGACGAGGGAGATGCCGATGAGGTGACGAAGCAGAGGATTCATGATGGAAAAGAGAAGCCAGGTGCTTTATGGCACATCTATGCAGCCAAGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yishu Wang et al.
FEBS open bio, 10(4), 637-643 (2020-02-29)
Ferroptosis is a type of adaptive cell death driven by cellular metabolism and iron-dependent lipid peroxidation. Though multiple genes (including SLC7A11 and GPX4) have been demonstrated to play key roles in ferroptosis, little is known about the epigenetic regulation of
Francisco Saavedra et al.
Epigenetics & chromatin, 13(1), 6-6 (2020-02-20)
Maintaining a proper supply of soluble histones throughout the cell cycle is important to ensure chromatin and genome stability. Following their synthesis, histones undergo a series of maturation steps to prepare them for deposition onto chromatin. Here, we identify the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service