Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCAGGAGGAGGACAGTTACGAGATCTTCATCTGTCACGCCAACGTCATCCGCTACATCGTGTGCAGCATCCCGCCGCTGTTGTCCGCTGGGGATTTTGTGCTTCTGGGGTCCTGACCTCTTTCACTTGCTGATCTGTGGGCGCTCCCACCCGTGTGCCAGCGTGACGGCTCGGGGTGTCCGCTCCCCTCTGGGTCGAGGCCACAGCTGAGTCACGTTGCTGCTCGGGCTGCTCCCTCGGGGGGCCCTTGTCCCTCAACCTGCTCTGGTGCCCCACTCTCAGCACCACAGAATGATCCGGGTTCAGGTTGCGTTTTCCCTGCCACCACCCTGCAATCAGCCACTTCTTTAAGGAGCTCCAGGGCTGCAGCCACGTTAGAGGGCCCCTTGGGGGGCAGGGCCAGCTCTACGGTTACATGCCTGAAACAGTCAGAAGGGTTGGCCAAATCTC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PGAM5(192111)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jeong-Min Hong et al.
Life sciences, 200, 94-104 (2018-03-11)
Heme oxygenase-1 (HO-1), an endogenous cytoprotective enzyme, is reported that can be localized in mitochondria under stress, contributing to preserve mitochondrial function. Mitochondrial quality control (QC) is essential to cellular health and recovery linked with redox homeostasis. Recent studies reported
Yuhua Chen et al.
Antioxidants & redox signaling, 34(2), 154-170 (2020-04-08)
Aims: Traumatic brain injury (TBI) is a major cause of disability and death, and a better understanding of the underlying mechanisms of mitochondrial dysfunction will provide important targets for preventing damage from neuronal insults. Phosphoglycerate mutase 5 (PGAM5) is localized
Wei Zuo et al.
European journal of pharmacology, 880, 173143-173143 (2020-05-04)
Growing evidence have suggested that mitophagy could exert a neuroprotective role in brain ischemia by removing the damaged mitochondria. However the upstream mechanisms of mitophagy are remain unclear. We previously observed a decrease of miR-330 in a miRNA profile of
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU145401-50UG | 04061828425594 |
| EHU145401-20UG | 04061831365665 |