Skip to Content
Merck
CN

EHU145711

MISSION® esiRNA

targeting human STOML2

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGAGAGGCCAGTGCAGTTCTGGCGAAGGCCAAGGCTAAAGCTGAAGCTATTCGAATCCTGGCTGCAGCTCTGACACAACATAATGGAGATGCAGCAGCTTCACTGACTGTGGCCGAGCAGTATGTCAGCGCGTTCTCCAAACTGGCCAAGGACTCCAACACTATCCTACTGCCCTCCAACCCTGGCGATGTCACCAGCATGGTGGCTCAGGCCATGGGTGTATATGGAGCCCTCACCAAAGCCCCAGTGCCAGGGACTCCAGACTCACTCTCCAGTGGGAGCAGCAGAGATGTCCAGGGTACAGATGCAAGTCTTGATGAGGAACTTGATCGAGTCAAGATGAGTTAGTGGAGCTGGGCTTGGCCAGGGAGTCTGGGAACAAGGAAGCAGATTTTCCTGATTCTGGCTCTAGCTTCCCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wenfeng Cao et al.
PloS one, 8(5), e63890-e63890 (2013-05-15)
Stomatin-like protein 2 (SLP-2), a member of the Stomatin superfamily, has been identified as an oncogenic-related protein and found to be up-regulated in multi-cancers. Nonetheless, the expression pattern and regulation of SLP-2 in human esophageal squamous cell carcinoma (ESCC) remain
Guolin Hu et al.
Cancer science, 109(5), 1357-1368 (2018-03-09)
Stomatin-like protein 2 (STOML2 or SLP-2) is an oncogenic anti-apoptotic protein that is upregulated in several types of cancer, including cervical cancer. However, the mechanisms responsible for the SLP-2 anti-apoptotic function remain poorly understood. Here, we show that siRNA-mediated SLP-2

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service