Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
Quality Level
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGTTGCTGGATTAGCTTGGATCACCACCATTATTATTCTGGTTCTTGGCATGTCCATGTATTACCGGACCATTCTTCTGGACTCTAATTGGTGGCCCCTAACTGAATTTGGAATTAACGTTGCCTTGTTTATTTTGTATATGGCCGCAGCCATAGTCTATGTGAATGATACCAACCGAGGTGGCCTCTGCTACTATCCGTTATTTAATACACCAGTGAATGCAGTGTTCTGCCGGGTAGAAGGAGGACAGATAGCTGCAATGATCTTCCTGTTTGTCACCATGATAGTTTATCTCATTAGTGCTTTGGTTTGCCTAAAGTTATGGAGGCATGAGGCAGCTCGGAGACATAGAGAATATATGGAACAACAGGAGATAAATGAGCCATCATTGTCATCGAAAAGGAAAATGTGTGAAATGGCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MARVELD2(153562)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Timothy Smyth et al.
Particle and fibre toxicology, 17(1), 52-52 (2020-10-17)
While exposure to diesel exhaust particles has been linked to aberrant immune responses in allergic diseases such as asthma, little attention has been paid to their effects on the airway epithelial barrier. In this study, we sought to determine the
Susanne M Krug
Annals of the New York Academy of Sciences, 1397(1), 219-230 (2017-06-13)
The tricellular tight junction (tTJ) is a potential weak point of the paracellular barrier. For solving the proportional contribution of the tTJ, ion conductances and macromolecule permeabilities were analyzed in cell lines of different leakiness. MDCK II, Caco-2, and HT-29/B6
Lawrence C S Tam et al.
Scientific reports, 7, 40717-40717 (2017-01-17)
The juxtacanalicular connective tissue of the trabecular meshwork together with inner wall endothelium of Schlemm's canal (SC) provide the bulk of resistance to aqueous outflow from the anterior chamber. Endothelial cells lining SC elaborate tight junctions (TJs), down-regulation of which
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU145931-50UG | 04061828426102 |
| EHU145931-20UG | 04061828651573 |