Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GACATTTCCACCTGGACACCTGACCATGTGCCTGCCCTGAGCAGCGAGGCCCACCAGGCATCTCTGTTGTGGGCAGCAGGGCCAGGTCCTGGTCTGTGGACCCTCGGCAGTTGGCAGGCTCCCTCTGCAGTGGGGTCTGGGCCTCGGCCCCACCATGTCGAGCCTCGGCGGTGGCTCCCAGGATGCCGGCGGCAGTAGCAGCAGCAGCACCAATGGCAGCGGTGGCAGTGGCAGCAGTGGCCCAAAGGCAGGAGCAGCAGACAAGAGTGCAGTGGTGGCTGCCGCCGCACCAGCCTCAGTGGCAGATGACACACCACCCCCCGAGCGTCGGAACAAGAGCGGTATCATCAGTGAGCCCCTCAACAAGAGCCTGCGCCGCTCCCGCCCGCTCTCCCACTACTCTTCTTTTGGCAGCAGTGGT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CXXC5(51523)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Zhibin Cui et al.
Scientific reports, 7, 40325-40325 (2017-01-10)
Malignant peripheral nerve sheath tumors (MPNSTs) are a type of rare sarcomas with a poor prognosis due to its highly invasive nature and limited treatment options. Currently there is no targeted-cancer therapy for this type of malignancy. Thus, it is
Gamze Ayaz et al.
Scientific reports, 10(1), 5971-5971 (2020-04-07)
Evidence suggests that the CXXC type zinc finger (ZF-CXXC) protein 5 (CXXC5) is a critical regulator/integrator of various signaling pathways that include the estrogen (E2)-estrogen receptor α (ERα). Due to its ZF-CXXC domain, CXXC5 is considered to be a member
Pelin Yaşar et al.
Scientific reports, 6, 37808-37808 (2016-11-26)
17β-estradiol (E2), the primary circulating estrogen hormone, mediates physiological and pathophysiological functions of breast tissue mainly through estrogen receptor α (ERα). Upon binding to E2, ERα modulates the expression of target genes involved in the regulation of cellular proliferation primarily
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU146121-20UG | 04061828651733 |
| EHU146121-50UG | 04061828426287 |