Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATGGTGACCTCGATCCTGAGATTGTAAAGTCATTCCTCTTCCAGCTACTAAAAGGGCTGGGATTCTGTCATAGCCGCAATGTGCTACACAGGGACCTGAAGCCCCAGAACCTGCTAATAAACAGGAATGGGGAGCTGAAATTGGCTGATTTTGGCCTGGCTCGAGCCTTTGGGATTCCCGTCCGCTGTTACTCAGCTGAGGTGGTCACACTGTGGTACCGCCCACCGGATGTCCTCTTTGGGGCCAAGCTGTACTCCACGTCCATCGACATGTGGTCAGCCGGCTGCATCTTTGCAGAGCTGGCCAATGCTGGGCGGCCTCTTTTTCCCGGCAATGATGTCGATGACCACTTGATCCTTGACTCCGTGGACACACTGCTGGGGACGCCCACCGAGGAGCAGTGGCCCTCTATGAC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CDK5(1020)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jie Zeng et al.
Journal of Cancer, 9(21), 3950-3961 (2018-11-10)
Cyclin-dependent kinase 5 (CDK5), an atypical member of the cyclin-dependent kinase family, plays an important role in the nervous system. Recent studies have shown that CDK5 is also associated with tumors. However, few studies have been done to investigate the
Hailong Tang et al.
International journal of molecular medicine, 45(6), 1661-1672 (2020-04-03)
The emergence of new drugs is a major feature of the treatment history of multiple myeloma (MM), which also reflects the current incurability of MM. As a unique member of cyclin dependent kinase (CDK) family, CDK5 participates in numerous tumorigenic
Johanna Liebl et al.
Nature communications, 6, 7274-7274 (2015-06-02)
The lymphatic system maintains tissue fluid balance, and dysfunction of lymphatic vessels and valves causes human lymphedema syndromes. Yet, our knowledge of the molecular mechanisms underlying lymphatic vessel development is still limited. Here, we show that cyclin-dependent kinase 5 (Cdk5)
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU147091-50UG | 04061828427093 |
| EHU147091-20UG | 04061828652433 |