Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCCTTGAAGGAGAAGCACATCACAGACATGGTGTGCCCTGCCTGTGGCCGCCCCGACCTCACCGATGACACACAGTTGCTCAGCTACTTCTCTACCCTTGACATCCAGCTTCGCGAGAGCCTAGAGCCAGATGCCTATGCGTTGTTCCATAAGAAGCTGACCGAGGGTGTGCTGATGCGGGACCCCAAGTTCTTGTGGTGTGCCCAGTGCTCCTTTGGCTTCATATATGAGCGTGAGCAGCTGGAGGCAACTTGTCCCCAGTGTCACCAGACCTTCTGTGTGCGCTGCAAGCGCCAGTGGGAGGAGCAGCACCGAGGTCGGAGCTGTGAGGACTTCCAGAACTGGAAACGCATGAACGACCCAGAATACCAGGCCCAGGGCCTAGCAATGTATCTTCAGGAAAACGGCATTGACTGCCCCAAATGCAAGTTCTCGTACGCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... RNF31(55072)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Julia Zinngrebe et al.
The Journal of experimental medicine, 213(12), 2671-2689 (2016-11-05)
The linear ubiquitin chain assembly complex (LUBAC), consisting of SHANK-associated RH-domain-interacting protein (SHARPIN), heme-oxidized IRP2 ubiquitin ligase-1 (HOIL-1), and HOIL-1-interacting protein (HOIP), is a critical regulator of inflammation and immunity. This is highlighted by the fact that patients with perturbed
Meraj H Khan et al.
Journal of cell science, 130(18), 3094-3107 (2017-08-05)
Sharpin, a multifunctional adaptor protein, regulates several signalling pathways. For example, Sharpin enhances signal-induced NF-κB signalling as part of the linear ubiquitin assembly complex (LUBAC) and inhibits integrins, the T cell receptor, caspase 1 and PTEN. However, despite recent insights
Eva M van Well et al.
The EMBO journal, 38(9) (2019-03-20)
Neurodegenerative diseases are characterized by the accumulation of misfolded proteins in the brain. Insights into protein quality control mechanisms to prevent neuronal dysfunction and cell death are crucial in developing causal therapies. Here, we report that various disease-associated protein aggregates
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU147451-20UG | 04061828652655 |
| EHU147451-50UG | 04061831376081 |