Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTTGAAGCAGGACATCAGCATCCCCGACTACTGCAGCCTGGGCGATGGGGAGGAGGAGGAAATCACCATCAATGCCTGGTTTGGTCCCCAGGGAACCATCTCCCCACTACATCAGGATCCCCAGCAAAACTTCCTAGTGCAGGTGATGGGGAGGAAGTACATCCGGCTGTATTCCCCGCAGGAGTCAGGGGCTCTGTACCCTCATGACACGCACCTTCTCCATAACACGAGCCAGGTTGACGTGGAGAATCCCGACCTGGAAAAGTTCCCCAAGTTTGCCAAGGCCCCATTCCTGTCCTGCATCCTGTCTCCTGGAGAGATCCTGTTCATCCCGGTGAAATACTGGCATTACGTGCGGGCTCTGGATTTGAGCTTCTCGGTCAGCTTCTGGTGGTCGTAGCCAGGATAGGAGCTGAAAGGGCCT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... KDM8(79831), JMJD5(79831)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Biochem/physiol Actions
JMJD5 (jumonji domain-containing protein 5) exhibits histone H3 lysine 36 dimethylation (H3K36me2) demethylase activity and thereby is associated with gene transcription regulation. In addition, it also has hydroxylase activity and controls osteoclastogenesis. It is linked with cell cycle progression in breast cancer cells, chromosome segregation with the help of RCCD1 (RCC1 domain-containing protein 1), metabolism by controlling PKM2 (pyruvate kinase muscle isozyme) nuclear translocation, microtubule stability and mitotic progression. It also participates in HBV (Hepatitis B virus) replication.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
JMJD5 (Jumonji Domain-containing 5) Associates with Spindle Microtubules and Is Required for Proper Mitosis.
He Z
The Journal of Biological Chemistry, 291, 4684-4684 (2016)
Ru Zhang et al.
International journal of clinical and experimental pathology, 8(6), 6482-6489 (2015-08-12)
To observe the effects of Jumonji C domain-containing (JMJD) 5 depletion on colon cancer (CC). A short-hairpin RNA targeting JMJD5 was transfected into a lentivirus to make Lv-shJMJD5 for infection into the Caco-2 human cell. Besides, a negative control shRNA
Takahisa Kouwaki et al.
Journal of virology, 90(7), 3530-3542 (2016-01-23)
Hepatitis B virus (HBV) is a causative agent for chronic liver diseases such as hepatitis, cirrhosis, and hepatocellular carcinoma (HCC). HBx protein encoded by the HBV genome plays crucial roles not only in pathogenesis but also in replication of HBV.
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU149061-50UG | 04061831376135 |
| EHU149061-20UG | 04061831366174 |