Skip to Content
Merck
CN

EHU149571

Sigma-Aldrich

MISSION® esiRNA

targeting human MUC4

Sign Into View Organizational & Contract Pricing

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTCAGATGCGATGGCTACAAGGGCTACGACCTGGTCTACAGCCCCCAGAGCGGCTTCACCTGCGTGTCCCCGTGCAGTAGGGGCTACTGTGACCATGGAGGCCAGTGCCAGCACCTGCCCAGTGGGCCCCGCTGCAGCTGTGTGTCCTTCTCCATCTACACGGCCTGGGGCGAGCACTGTGAGCACCTGAGCATGAAAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Lu-Yan Shen et al.
Oncotarget, 7(4), 4531-4541 (2015-12-18)
Heterogeneous efficacy of neoadjuvant chemotherapy has led to controversies that have limited its application in clinical practice. Thus, we aimed to identify potential biomarkers predicting esophageal squamous cell carcinoma (ESCC) chemo-responsiveness by gene expression profiling. CCK8 assay was used to
Dongkui Xu et al.
Biochemical and biophysical research communications, 485(2), 556-562 (2016-12-08)
The dysregulated molecules and their involvement in lymph node metastases of cervical cancer are far from been fully revealed. In this study, by reviewing MUC4 expression in The Human Protein Atlas and retrieving gene microarray data in GEO dataset (No.
Se-Ra Lee et al.
International journal of molecular sciences, 20(11) (2019-05-31)
Tristetraprolin (TTP), a well-characterized AU-rich element (ARE) binding protein, functions as a tumor suppressor gene. The purpose of this study was to investigate whether a bioactive substance derived from a natural medicinal plant affects the induction of TTP and to

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service