Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTTCAGATGCGATGGCTACAAGGGCTACGACCTGGTCTACAGCCCCCAGAGCGGCTTCACCTGCGTGTCCCCGTGCAGTAGGGGCTACTGTGACCATGGAGGCCAGTGCCAGCACCTGCCCAGTGGGCCCCGCTGCAGCTGTGTGTCCTTCTCCATCTACACGGCCTGGGGCGAGCACTGTGAGCACCTGAGCATGAAAC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MUC4(4585)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Dongkui Xu et al.
Biochemical and biophysical research communications, 485(2), 556-562 (2016-12-08)
The dysregulated molecules and their involvement in lymph node metastases of cervical cancer are far from been fully revealed. In this study, by reviewing MUC4 expression in The Human Protein Atlas and retrieving gene microarray data in GEO dataset (No.
Lu-Yan Shen et al.
Oncotarget, 7(4), 4531-4541 (2015-12-18)
Heterogeneous efficacy of neoadjuvant chemotherapy has led to controversies that have limited its application in clinical practice. Thus, we aimed to identify potential biomarkers predicting esophageal squamous cell carcinoma (ESCC) chemo-responsiveness by gene expression profiling. CCK8 assay was used to
Se-Ra Lee et al.
International journal of molecular sciences, 20(11) (2019-05-31)
Tristetraprolin (TTP), a well-characterized AU-rich element (ARE) binding protein, functions as a tumor suppressor gene. The purpose of this study was to investigate whether a bioactive substance derived from a natural medicinal plant affects the induction of TTP and to
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU149571-20UG | 04061828633760 |
| EHU149571-50UG | 04061828406272 |