Skip to Content
Merck
CN

EHU150021

MISSION® esiRNA

targeting human ALAD

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCGGTGATGAGCTACAGTGCCAAATTTGCTTCCTGTTTCTATGGCCCTTTCCGGGATGCAGCTAAGTCAAGCCCAGCTTTTGGGGACCGCCGCTGCTACCAGCTGCCCCCTGGAGCACGAGGCCTGGCTCTCCGAGCTGTGGACCGGGATGTACGGGAAGGAGCTGACATGCTCATGGTGAAGCCGGGAATGCCCTACCTGGACATCGTGCGGGAGGTAAAGGACAAGCACCCTGACCTCCCTCTCGCCGTGTACCACGTCTCTGGAGAGTTTGCCATGCTGTGGCATGGAGCCCAGGCCGGGGCATTTGATCTCAAGGCTGCCGTACTGGAGGCCATGACTGCCTTCCGCAGAGCAGGTGCTGACATCATCATCACCTACTACACACCGCAGCTGCTGCAGTGGCTGAAGGAGGAATGATGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ALAD(210), ALAD(210)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhou Zheng et al.
Fish & shellfish immunology, 81, 168-175 (2018-07-17)
Shrimps, which mainly rely on their innate immune system to response to infectious pathogens, have clottable proteins as an important component of this system. While transglutaminases (TGase) are found in Litopenaeus vannamei and constitute part of the coagulation system, the
Guicai Gao et al.
Developmental and comparative immunology, 98, 99-107 (2019-05-06)
White spot syndrome, which is caused by white spot syndrome virus (WSSV), is a highly contagious disease of penaeid shrimp. However, there is currently incomplete understanding of the infection mechanism and pathogenesis of WSSV. In this study, a novel gene
Gang Liu et al.
Nature communications, 11(1), 6310-6310 (2020-12-11)
Heme biosynthesis and iron-sulfur cluster (ISC) biogenesis are two major mammalian metabolic pathways that require iron. It has long been known that these two pathways interconnect, but the previously described interactions do not fully explain why heme biosynthesis depends on

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service