Skip to Content
Merck
CN

EHU150591

MISSION® esiRNA

targeting human CIITA

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCGACACAGACACCATCAACTGCGACCAGTTCAGCAGGCTGTTGTGTGACATGGAAGGTGATGAAGAGACCAGGGAGGCTTATGCCAATATCGCGGAACTGGACCAGTATGTCTTCCAGGACTCCCAGCTGGAGGGCCTGAGCAAGGACATTTTCAAGCACATAGGACCAGATGAAGTGATCGGTGAGAGTATGGAGATGCCAGCAGAAGTTGGGCAGAAAAGTCAGAAAAGACCCTTCCCAGAGGAGCTTCCGGCAGACCTGAAGCACTGGAAGCCAGCTGAGCCCCCCACTGTGGTGACTGGCAGTCTCCTAGTGAGACCAGTGAGCGACTGCTCCACCCTGCCCTGCCTGCCACTGCCTGCGCTGTTCAACCAGGAGCCAGCCTCCGGCCAGATGCGCCTGGAGAAAACCGACCAGATTCCCATGCCTTTCTCCAGTTCCTCGTTGAGCTGCCTGAATCTCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shaylynn Miller et al.
Annals of the rheumatic diseases, 78(4), 519-528 (2019-01-25)
We examined genome-wide DNA methylation changes in CD8+ T cells from patients with lupus and controls and investigated the functional relevance of some of these changes in lupus. Genome-wide DNA methylation of lupus and age, sex and ethnicity-matched control CD8+
Hiroaki Nagatomo et al.
The Japanese journal of veterinary research, 63(4), 159-171 (2016-01-13)
There has been no work on spatiotemporal transcriptomic differences of blastocysts using in vivo- and in vitro-derived, and somatic cell nuclear transfer (SCNT) embryos. Here, we first compared the lineage-differentially transcriptomic profiles of in vivo- and in vitro-derived embryos by

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service