Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AACATGCCCATTCGCTTTACCAAGATCTTCTACAATCAGCAAAACCACTATGATGGCTCCACTGGTAAATTCCACTGCAACATTCCTGGGCTGTACTACTTTGCCTACCACATCACAGTCTATATGAAGGATGTGAAGGTCAGCCTCTTCAAGAAGGACAAGGCTATGCTCTTCACCTATGATCAGTACCAGGAAAATAATGTGGACCAGGCCTCCGGCTCTGTGCTCCTGCATCTGGAGGTGGGCGACCAAGTCTGGCTCCAGGTGTATGGGGAAGGAGAGCGTAATGGACTCTATGCTGATAATGACAATGACTCCACCTTCACAGGCTTTCTTCTCTACCATGACACCAACTGATCACCACTAACTCAGAGCCTCCTCCAGGCCAAACAGCCCCAAAGTCAAT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ADIPOQ(9370)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Roberta G Marangoni et al.
Scientific reports, 7(1), 4397-4397 (2017-07-02)
Skin fibrosis in systemic sclerosis (SSc) is accompanied by attrition of dermal white adipose tissue (dWAT) and reduced levels of circulating adiponectin. Since adiponectin has potent regulatory effects on fibroblasts, we sought to assess adiponectin signaling in SSc skin biopsies
Juhyun Song et al.
Cell death & disease, 8(10), e3102-e3102 (2017-10-13)
Alzheimer's disease (AD) is the most common neurodegenerative disease, characterized by excessive beta amyloid (Aβ) deposition in brain, leading to blood-brain barrier (BBB) disruption. The mechanisms of BBB disruption in AD are still unclear, despite considerable research. The adipokine adiponectin
Yuu Okura et al.
International journal of molecular sciences, 20(7) (2019-04-03)
Both adiponectin and secreted protein, acidic and rich in cysteine (SPARC) inhibit platelet-derived growth factor-BB (PDGF-BB)-induced and basic fibroblast growth factor (FGF2)-induced angiogenic activities through direct and indirect interactions. Although SPARC enhances nerve growth factor (NGF)-dependent neurogenesis, the physical interaction
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU150631-50UG | 04061828407163 |
| EHU150631-20UG | 04061828634392 |