Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AAGGGGATGTGCACAAAAAGAAAGAAATCATCCAAGATGTGACCTTGCATGACTTGGATGTGGCTAATGCGCGGCCCCAGGGGGGACAAGATATCCTGTCCATGATGGGCCAGCTAATGAAGCCAAAGAAGACAGAAATCACAGACAAACTTCGAGGGGAGATTAATAAGGTGGTGAACAAGTACATCGACCAGGGCATTGCTGAGCTGGTCCCGGGTGTGCTGTTTGTTGATGAGGTCCACATGCTGGACATTGAGTGCTTCACCTACCTGCACCGCGCCCTGGAGTCTTCTATCGCTCCCATCGTCATCTTTGCATCCAACCGAGGCAACTGTGTCATCAGAGGCACTGAGGACATCACATCCCCTCACGGCATCCCTCTTGACCTTCTGGACCGAGTGATG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... RUVBL1(8607)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
O Breig et al.
Leukemia, 28(6), 1271-1279 (2013-12-18)
The oncogenic fusion protein AML1-ETO, also known as RUNX1-RUNX1T1 is generated by the t(8;21)(q22;q22) translocation, one of the most frequent chromosomal rearrangements in acute myeloid leukemia (AML). Identifying the genes that cooperate with or are required for the oncogenic activity
Fabian Zimmermann et al.
Science advances, 6(51) (2020-12-24)
The microtubule nucleator γ-tubulin ring complex (γTuRC) is essential for the function of microtubule organizing centers such as the centrosome. Since its discovery over two decades ago, γTuRC has evaded in vitro reconstitution and thus detailed structure-function studies. Here, we
M Jane Morwitzer et al.
Viruses, 11(4) (2019-04-26)
Ebola virus (EBOV) is a filovirus that has become a global public health threat in recent years. EBOV is the causative agent of a severe, often fatal hemorrhagic fever. A productive viral infection relies on the successful recruitment of host
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU150721-20UG | 04061831366365 |
| EHU150721-50UG | 04061828407255 |