Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGTTTGCCTGCCACAGCTACAATGAGTGTGTGGCCCTGGAGTATCGCTGTGACCGGCGGCCCGACTGCAGGGACATGTCTGATGAGCTCAATTGTGAGGAGCCAGTCCTGGGTATCAGCCCCACATTCTCTCTCCTTGTGGAGACGACATCTTTACCGCCCCGGCCAGAGACAACCATCATGCGACAGCCACCAGTCACCCACGCTCCTCAGCCCCTGCTTCCCGGTTCCGTCAGGCCCCTGCCCTGTGGGCCCCAGGAGGCCGCATGCCGCAATGGGCACTGCATCCCCAGAGACTACCTCTGCGACGGACAGGAGGACTGCGAGGACGGCAGCGATGAGCTAGACTGTGGCCCCCCGCCACCCTGTGAGCCCAACGAGTTCCCCTGCGGGAATGGACATTGTGCCCTCAAGCTGTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... HSPG2(3339)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Osama Garwain et al.
Cellular signalling, 71, 109620-109620 (2020-04-05)
Alzheimer's disease is typified by calcium dysfunction and neurofibrillary tangles of tau aggregates along with mitotic proteins. Using PC12 cells as a model system, we determined whether the Gαq/PLCβ/ calcium signaling pathway impacts the manifestation of Alzheimer's disease. Down-regulating PLCβ
Anne M Roesler et al.
Journal of cellular physiology, 234(8), 14187-14197 (2019-01-10)
Airway smooth muscle (ASM) regulation of airway structure and contractility is critical in fetal/neonatal physiology in health and disease. Fetal lungs experience higher Ca2+ environment that may impact extracellular Ca2+ ([Ca2+ ]o ) sensing receptor (CaSR). Well-known in the parathyroid
Cristián Ibarra et al.
Molecular oncology, 13(2), 202-211 (2018-10-26)
Bacillus Calmette-Guérin (BCG) is widely used in the clinic to effectively treat superficial urinary bladder cancer. However, a significant proportion of patients who fail to respond to BCG risk cystectomy or death. Though more than 3 million cancer treatments with
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU151431-20UG | 04061831366471 |
| EHU151431-50UG | 04061828407934 |