Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
Quality Level
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCCCTCCTCGGTGACTTATCCTGTGGTCCCCGGCAGCGTGGACGAGTCTCCCAGTGGAGCATTGAACATCGAATGTAGAATCTGCGGGGACAAGGCCTCAGGCTATCATTACGGAGTCCACGCGTGTGAAGGCTGCAAGGGCTTCTTTCGGCGAACGATTCGACTCAAGCTGGTGTATGACAAGTGCGACCGCAGCTGCAAGATCCAGAAAAAGAACAGAAACAAATGCCAGTATTGTCGATTTCACAAGTGCCTTTCTGTCGGGATGTCACACAACGCGATTCGTTTTGGACGAATGCCAAGATCTGAGAAAGCAAAACTGAAAGCAGAAATTCTTACCTGTGAACATGACATAGAAGATTCTGAAACTGCAGATCTCAAATCTCTGGCCAAGAGAATCTACGAGGCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PPARA(5465)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Hsu-Lung Jen et al.
Journal of atherosclerosis and thrombosis, 24(5), 508-517 (2016-09-16)
Previous studies demonstrated that endothelin-1 (ET-1) can significantly increase the cell size and stimulate adiponectin expression in cultured human cardiomyocytes (HCM). The aim of the present study was to investigate the effects of fenofibrate, a peroxisome proliferator-activated receptor-α (PPARα) activator
Tânia Vieira Madureira et al.
Comparative biochemistry and physiology. Part B, Biochemistry & molecular biology, 229, 1-9 (2018-12-12)
The crosstalk between peroxisome proliferator-activated receptor α (PPARα) and estrogenic pathways are shared from fish to humans. Salmonid fish had an additional genome duplication, and two PPARα isoforms (PPARαBa and PPARαBb) were previously identified. Since a negative regulation between estrogen
Maja Grabacka et al.
Archives of dermatological research, 309(3), 141-157 (2017-01-14)
Recent studies revealed the cooperation between peroxisome proliferator-activated receptor gamma (PPARγ) and α-MSH signaling, which results in enhanced melanogenesis in melanocytes and melanoma cells. However, the agonists of PPARα, such as fenofibrate, exert depigmenting effect. Therefore, we aimed to check
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU151821-50UG | 04061831376227 |
| EHU151821-20UG | 04061831366563 |