Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAACGCCTTGTATGTCCTCAGTCCCTTCCACCCCATCCGGAGAGCGGCTGTGAAGATTCTGCTTTCCTTGACCCCACGCACGCTCTTCAACATGCTCATCATGTGCACCATCCTCACCAACTGCGTGTTCATGGCCCAGCACGACCCTCCACCCTGGACCAAGTATGTCGAGTACACCTTCACCGCCATTTACACCTTTGAGTCTCTGGTCAAGATTCTGGCTCGAGGCTTCTGCCTGCACGCGTTCACTTTCCTTCGGGACCCATGGAACTGGCTGGACTTTAGTGTGATTATCATGGCATACACAACTGAATTTGTGGACCTGGGCAATGTCTCAGCCTTACGCACCTTCCGAGTCCTCCGGGCCCTGAAAACTATATCAGTCATTTCAGGGCTGAAGACCATCGTGGGGGCCCTGATCCAGTCTGTGAAGAAGCTGGCTGATG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SCN5A(6331)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ming Yang et al.
Journal of cellular physiology, 235(4), 3950-3972 (2019-10-16)
Ion channels can regulate the plasma membrane potential (Vm ) and cell migration as a result of altered ion flux. However, the mechanism by which Vm regulates motility remains unclear. Here, we show that the Nav 1.5 sodium channel carries
Wan-Lin Lo et al.
Nature immunology, 13(9), 880-887 (2012-07-31)
The sustained entry of Ca(2+) into CD4(+)CD8(+) double-positive thymocytes is required for positive selection. Here we identified a voltage-gated Na(+) channel (VGSC) that was essential for positive selection of CD4(+) T cells. Pharmacological inhibition of VGSC activity inhibited the sustained
Jie Zhang et al.
Acta biochimica et biophysica Sinica, 51(6), 562-570 (2019-05-30)
The protein voltage-gated sodium channel Nav1.5 is highly upregulated in various types of cancer and, in general, promotes cancer cell invasiveness and metastatic progression. A previous study found that Nav1.5 was highly expressed in poorly differentiated oral squamous cell carcinoma
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU151881-50UG | 04061828408337 |
| EHU151881-20UG | 04061828640690 |