Skip to Content
Merck
CN

EHU153321

MISSION® esiRNA

targeting human CCND1

Sign In to View Organizational & Contract Pricing

Select a Size

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

Key Documents

View All Documentation
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AACTACCTGGACCGCTTCCTGTCGCTGGAGCCCGTGAAAAAGAGCCGCCTGCAGCTGCTGGGGGCCACTTGCATGTTCGTGGCCTCTAAGATGAAGGAGACCATCCCCCTGACGGCCGAGAAGCTGTGCATCTACACCGACAACTCCATCCGGCCCGAGGAGCTGCTGCAAATGGAGCTGCTCCTGGTGAACAAGCTCAAGTGGAACCTGGCCGCAATGACCCCGCACGATTTCATTGAACACTTCCTCTCCAAAATGCCAGAGGCGGAGGAGAACAAACAGATCATCCGCAAACACGCGCAGACCTTCGTTGCCCTCTGTGCCACAGATGTGAAGTTCATTTCCAATCCGCCCTCCATGGTGGCAGCGGGGAGCGTGGTGGCCGCAGTGCAAGGCCTGAACCTGAGGAGCCCCAACAACTTCCTGTCCTACTACCGCCTCA

Ensembl | human accession no.

ENSG00000110092

NCBI accession no.

NM_053056

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CCND1(595), CCND1(595)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
ABGS
GJU
VAU
QYT
CJT

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Dexin Yin et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 49(4), 1499-1511 (2018-09-12)
Recent studies have suggested that several lncRNAs contribute to the angiogenic function of endothelial cells. Herein, we set out to reveal whether lncRNA UCA1 has functions in endothelial angiogenesis. The expression levels of lncRNA UCA1, miR-195 and CCND1 in human
Xiaohong Jiang et al.
Gene therapy, 27(12), 557-566 (2020-06-07)
LncRNAs are reported to participate in the progression of various diseases including diabetic nephropathy. Currently, we reported that SNHG16 was obviously upregulated in db/db mice and high glucose-treated mice mesangial cells. Then, functional experiments showed that SNHG16 silencing significantly inhibited
Ling Liu et al.
Die Pharmazie, 74(6), 369-373 (2019-05-30)
The aim of this study was to explore the role and regulatory mechanism of microRNA-298 (miR-298) in myocardial ischemic injury. H9c2 cardiomyocytes were cultured under hypoxia (3 % O₂) conditions to induce myocardial ischemic injury. Subsequently, the effects of miR-298
Ningning Li et al.
Oncogene, 37(31), 4313-4333 (2018-05-04)
To identify biomarkers for glioma growth, invasion and progression, we used a candidate gene approach in mouse models with two complementary brain tumour phenotypes, developing either slow-growing, diffusely infiltrating gliomas or highly proliferative, non-invasive primitive neural tumours. In a microRNA
Xi Chen et al.
Frontiers in molecular neuroscience, 12, 328-328 (2020-02-11)
Astrocytes are the most abundant type of glial cells in the brain, and they play a key role in Alzheimer's disease (AD). Fibroblast Growth Factor-2 (FGF-2) has been implicated as a potential therapeutic agent for treating AD. In the present
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service