Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTGAATGGGCCAATGATTCTAGTTTCAGAGTCTTGGAAGGATGAAGGTAGTGAATGTGAACCTGGATTTTTTTCGGAATGGTACATCCTTGCCATCACATCATTCTTGGAATTCGTGATCCCAGTCATCTTAGTCGCTTATTTCAACATGAATATTTATTGGAGCCTGTGGAAGCGTGATCATCTCAGTAGGTGCCAAAGCCATCCTGGACTGACTGCTGTCTCTTCCAACATCTGTGGACACTCATTCAGAGGTAGACTATCTTCAAGGAGATCTCTTTCTGCATCGACAGAAGTTCCTGCATCCTTTCATTCAGAGAGACAGAGGAGAAAGAGTAGTCTCATGTTTTCCTCAAGAACCAAGATGAATAGCAATACAATTGCTTCCAAAATGGGTTCCTTCTCCCAATCAGATTCTGTAGCTCTTCACCAAAGGGAACA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... HRH4(59340)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Anne-France Petit-Bertron et al.
PloS one, 4(8), e6504-e6504 (2009-08-08)
The most recently characterized H4 histamine receptor (H4R) is expressed preferentially in the bone marrow, raising the question of its role during hematopoiesis. Here we show that both murine and human progenitor cell populations express this receptor subtype on transcriptional
Angel Jemima Ebenezer et al.
Journal of receptor and signal transduction research, 38(3), 204-212 (2018-06-05)
Mast cell (MC) activation through H4R releases various inflammatory mediators which are associated with allergic asthma. To investigate the siRNA-mediated gene silencing effect of H4R on human mast cells (HMCs) functions and the activation of stress-activated protein kinases (SAPK)/jun amino-terminal
Angel Jemima Ebenezer et al.
Journal of receptor and signal transduction research, 37(2), 133-140 (2016-07-13)
The histamine H4 receptor functionally expressed on human mast cells and their signaling pathways for the production of IL-13 and RANTES have never been analyzed side by side in a directly comparable manner. Therefore, the aim of the study was
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU153641-20UG | 04061828635740 |
| EHU153641-50UG | 04061828409679 |