Skip to Content
Merck
CN

EHU154611

MISSION® esiRNA

targeting human KCNA3

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGTTCTCCTTCGAACTGCTGGTGCGGTTCTTCGCTTGTCCTAGCAAAGCCACCTTCTCGCGAAACATCATGAACCTGATCGACATTGTGGCCATCATTCCTTATTTTATCACTCTGGGTACCGAGCTGGCCGAACGACAGGGCAATGGACAGCAGGCCATGTCTCTGGCCATCCTGAGGGTCATCCGCCTGGTAAGGGTCTTCCGCATCTTCAAGCTGTCGCGCCACTCCAAGGGGCTGCAGATCCTCGGGCAAACGCTGAAGGCGTCCATGCGGGAGCTGGGATTGCTCATCTTCTTCCTCTTTATTGGGGTCATCCTTTTCTCCAGCGCGGTCTACTTTGCCGAGGCAGACGACCCCACTTCAGGTTTCAGCAGCATCCCGGATGCCTTCTGGTGGGCAGTGGTAACCATGACAACAGTGGGTTACGGCGATATGCACCCAGTGACCATAGGGGGCAAGATTGTGGGATCTCTCTGTGCCATCGCCGGTGTCTTGACCATCGCATTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiao-Hong Kan et al.
Archives of biochemistry and biophysics, 591, 150-156 (2016-01-10)
Ion channels expressed in macrophages have been tightly related to atherosclerosis by coupling cellular function. How the voltage-gated potassium channels (Kv) affect macrophage migration remain unknown. The aim of our study is to investigate whether Kv1.3-ERK signaling pathway plays an
Marat Khodoun et al.
Science advances, 6(47) (2020-11-20)
Lupus nephritis (LN) is an autoimmune disease with substantial morbidity/mortality and limited efficacy of available therapies. Memory T (Tm) lymphocytes infiltrate LN kidneys, contributing to organ damage. Analysis of LN, diabetic nephropathy, and healthy donor kidney biopsies revealed high infiltration
Roberta Peruzzo et al.
Redox biology, 37, 101705-101705 (2020-10-03)
The potassium channel Kv1.3, involved in several important pathologies, is the target of a family of psoralen-based drugs whose mechanism of action is not fully understood. Here we provide evidence for a physical interaction of the mitochondria-located Kv1.3 (mtKv1.3) and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service