Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACTCGCCAGAAGATTGGAGAAGAGGCTATGTTTAATCCTCAACTCATGATACAGACCCCTAAAGAAGAAGGTGCTAATGTCCTGACCACAGAAGCGCTCCTACAACACCTGGACTCGGCACTCCAGGCCAGCCGTGTCCATGTATACATGTACAACAGGCAGTGGAAATTGGAACATTTGTGTTACAAATCAGGAGAGCTTATCACAGAAACAGGTTACATGGATCAGATAATAGAATATCTTTACCCTTGTTTGATTATTACACCTTTGGACTGCTTCTGGGAAGGGGCGAAATTACAGTCTGGGACAGCATACCTCCTAGGTAAACCTCCTTTGCGGTGGACAAACTTCGACCCTTTGGAATTCCTGGAAGAGTTAAAGAAAATAAACTATCAAGTGGACAGCTGGGAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PTCH1(5727)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yingying Hong et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 31(7), 1413-1428 (2016-02-19)
Nevoid basal cell carcinoma syndrome (NBCCS) is an autosomal dominant disorder characterized by bone and skin abnormalities and a predisposition to various tumors. Keratocystic odontogenic tumors (KCOTs), which are common tumors of the jaw that cause extensive damage to the
Xuechao Wan et al.
Oncotarget, 9(4), 4798-4813 (2018-02-13)
Metastasis is the most common cause of mortality for non-small cell lung cancer (NSCLC). PTCH1, a receptor of Hedgehog (Hh) pathway, is reported to suppress cell proliferation. Interestingly, our previous study showed PTCH1 silencing promoted cell proliferation but inhibited cell
A Tam et al.
Scientific reports, 9(1), 3353-3353 (2019-03-06)
Genome-wide association studies have linked gene variants of the receptor patched homolog 1 (PTCH1) with chronic obstructive pulmonary disease (COPD). However, its biological role in the disease is unclear. Our objective was to determine the expression pattern and biological role
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU155311-20UG | 04061828642199 |
| EHU155311-50UG | 04061831376432 |