Skip to Content
Merck
CN

EHU155311

Sigma-Aldrich

MISSION® esiRNA

targeting human PTCH1

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTCGCCAGAAGATTGGAGAAGAGGCTATGTTTAATCCTCAACTCATGATACAGACCCCTAAAGAAGAAGGTGCTAATGTCCTGACCACAGAAGCGCTCCTACAACACCTGGACTCGGCACTCCAGGCCAGCCGTGTCCATGTATACATGTACAACAGGCAGTGGAAATTGGAACATTTGTGTTACAAATCAGGAGAGCTTATCACAGAAACAGGTTACATGGATCAGATAATAGAATATCTTTACCCTTGTTTGATTATTACACCTTTGGACTGCTTCTGGGAAGGGGCGAAATTACAGTCTGGGACAGCATACCTCCTAGGTAAACCTCCTTTGCGGTGGACAAACTTCGACCCTTTGGAATTCCTGGAAGAGTTAAAGAAAATAAACTATCAAGTGGACAGCTGGGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yingying Hong et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 31(7), 1413-1428 (2016-02-19)
Nevoid basal cell carcinoma syndrome (NBCCS) is an autosomal dominant disorder characterized by bone and skin abnormalities and a predisposition to various tumors. Keratocystic odontogenic tumors (KCOTs), which are common tumors of the jaw that cause extensive damage to the
Xuechao Wan et al.
Oncotarget, 9(4), 4798-4813 (2018-02-13)
Metastasis is the most common cause of mortality for non-small cell lung cancer (NSCLC). PTCH1, a receptor of Hedgehog (Hh) pathway, is reported to suppress cell proliferation. Interestingly, our previous study showed PTCH1 silencing promoted cell proliferation but inhibited cell
A Tam et al.
Scientific reports, 9(1), 3353-3353 (2019-03-06)
Genome-wide association studies have linked gene variants of the receptor patched homolog 1 (PTCH1) with chronic obstructive pulmonary disease (COPD). However, its biological role in the disease is unclear. Our objective was to determine the expression pattern and biological role
Jeanne L Theis et al.
eLife, 9 (2020-10-03)
Congenital heart diseases (CHDs), including hypoplastic left heart syndrome (HLHS), are genetically complex and poorly understood. Here, a multidisciplinary platform was established to functionally evaluate novel CHD gene candidates, based on whole-genome and iPSC RNA sequencing of a HLHS family-trio.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service