Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GACTCCAGCCTCCTCAACTGCGCCCCCCATAAGCTCCGGGCCCGGGGCGCTGGCCTCTGTGCCCGCCTCTCACCCGGCACACGGCTTGGCACCCCACGAGTCCCAGCTGCACCTGAAAGGGGACCCCCACTACTCCTTCAACCACCCGTTCTCCATCAACAACCTCATGTCCTCCTCGGAGCAGCAGCATAAGCTGGACTTCAAGGCATACGAACAGGCACTGCAATACTCGCCTTACGGCTCTACGTTGCCCGCCAGCCTGCCTCTAGGCAGCGCCTCGGTGACCACCAGGAGCCCCATCGAGCCCTCAGCCCTGGAGCCGGCGTACTACCAAGGTGTGTATTCCAGACCCGTCCTAAACACTTCCTAGCTCCCGGGACTGGGGGGTTTGTCTGGCATAGCCAT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... FOXA1(3169)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Shixiong Wang et al.
International journal of molecular sciences, 19(12) (2018-12-24)
Forkhead box A1 (FOXA1) belongs to the forkhead class transcription factor family, playing pioneering function for hormone receptors in breast and prostate cancers, and mediating activation of linage specific enhancers. Interplay between FOXA1 and breast cancer specific signaling pathways has
Erina Anzai et al.
Biological & pharmaceutical bulletin, 40(9), 1483-1489 (2017-09-05)
Epithelial-to-mesenchymal transition (EMT) is an important process during embryonic development and tumor progression by which adherent epithelial cells acquire mesenchymal properties. Forkhead box protein A1 (FOXA1) is a transcriptional regulator preferentially expressed in epithelial breast cancer cells, and its expression
Shijun Lu et al.
Inflammation research : official journal of the European Histamine Research Society ... [et al.], 69(7), 645-656 (2020-04-29)
Nowadays, sepsis-induced acute kidney injury (AKI) has gradually become a global problem for its high incidence and increasing mortality. Previous study has reported lncRNA ENST00000452391.1 in sepsis patients. However, its potential biological function and downstream molecular mechanism are still mysterious.
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU155811-20UG | 04061831367171 |
| EHU155811-50UG | 04061831376456 |