Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTGAGGACTCTAGGCGGACAGAGTCCACGCCGGCTGGTAGCGAGAACACTAAGGACATTCGGCTGTAGGAGCAGAACACTTCAGCCTGTGCAGGTTTATATTGGGAAGCTGTAGAGGACCAGGACTTGTGCAGACGCCACAGTCTCCCCAGATATGGACCATCAGTGACTCATGCTGGATGACCCCATGCTCCGTCATTTGACAGGGGCTCAGGATATTCACTCTGTGGTCCAGAGTCAACTGTTCCCATAACCCCTAGTCATCGTTTGTGTGTATAAGTTGGGGGAATTAAGTTTCAAGAAAGGCAAGAGCTCAAGGTCAATGACACCCCTGGCCTGACTCCCATGCAAGTAGCTGGCTGTACTGCCAAGGTACCTAGGTTGGAGTCCAGCCTAATCAAGTCAAATGGAGAAACAGGCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... P2RY2(5029)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jiang-Lan Zhang et al.
Cancer science, 108(7), 1318-1327 (2017-05-06)
Extracellular adenosine 5'-triphosphate (ATP), secreted by living cancer cells or released by necrotic tumor cells, plays an important role in tumor invasion and metastasis. Our previous study demonstrated that ATP treatment in vitro could promote invasion in human prostate cancer
Hana Jin et al.
International journal of oncology, 53(5), 1953-1966 (2018-09-19)
In the tumor microenvironment, extracellular nucleotides are released and accumulate, and can activate the P2Y2 receptor (P2Y2R), which regulates various responses in tumor cells, resulting in tumor progression and metastasis. Moreover, the inflammasome has recently been reported to be associated
Ramasri Sathanoori et al.
Cellular and molecular life sciences : CMLS, 74(4), 731-746 (2016-09-22)
Endothelial cells release ATP in response to fluid shear stress, which activates purinergic (P2) receptor-mediated signaling molecules including endothelial nitric oxide (eNOS), a regulator of vascular tone. While P2 receptor-mediated signaling in the vasculature is well studied, the role of
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU156731-50UG | 04061828418275 |
| EHU156731-20UG | 04061831367317 |