Skip to Content
Merck
CN

EHU156781

MISSION® esiRNA

targeting human TRPV4

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCGAGGTCATTACGCTCTTCACTGGGGTCCTGTTCTTCTTCACCAACATCAAAGACTTGTTCATGAAGAAATGCCCTGGAGTGAATTCTCTCTTCATTGATGGCTCCTTCCAGCTGCTCTACTTCATCTACTCTGTCCTGGTGATCGTCTCAGCAGCCCTCTACCTGGCAGGGATCGAGGCCTACCTGGCCGTGATGGTCTTTGCCCTGGTCCTGGGCTGGATGAATGCCCTTTACTTCACCCGTGGGCTGAAGCTGACGGGGACCTATAGCATCATGATCCAGAAGATTCTCTTCAAGGACCTTTTCCGATTCCTGCTCGTCTACTTGCTCTTCATGATCGGCTACGCTTCAGCCCTGGTCTCCCTCCTGAACCCGTGTGCCAACATGAAGGTGTGCAATGAGGACCAGACCAACTGCACAGTGCCCACTTACCCCTCGTGCCGTGACAGCGAGACCTTCAGCACCTTCCTCCTGGACCTGTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hengli Zhao et al.
Frontiers in molecular neuroscience, 11, 97-97 (2018-04-11)
Blood-brain barrier (BBB) disruption and subsequent brain edema play important roles in the secondary neuronal death and neurological dysfunction that are observed following intracerebral hemorrhage (ICH). In previous studies, transient receptor potential vanilloid 4 (TRPV4), a calcium-permeable mechanosensitive channel, was
Boran Cao et al.
Journal of cellular physiology, 234(5), 6831-6841 (2018-11-06)
The aim of this study is to evaluate the effect of transient receptor potential vanilloid 4 (TRPV4) on osteoclast differentiation and osteoporosis, and to investigate the underlying mechanism. The results showed that TRPV4 expression and intracellular Ca2+ concentration were significantly
Yuanzheng Gu et al.
The Journal of cell biology, 216(7), 2179-2199 (2017-06-14)
Little is known about mechanical regulation of morphological and functional polarity of central neurons. In this study, we report that mechanical stress specifically induces varicosities in the axons but not the dendrites of central neurons by activating TRPV4, a Ca
Farai Gombedza et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 31(4), 1556-1570 (2017-01-12)
Contributions of mechanical signals to airway remodeling during asthma are poorly understood. Transient receptor potential vanilloid 4 (TRPV4), a mechanosensitive ion channel, has been implicated in cardiac and pulmonary fibrosis; however, its role in asthma remains elusive. Employing a
Hanan Awad Alkozi et al.
Experimental eye research, 162, 1-8 (2017-06-29)
Melatonin is a substance synthesized in the pineal gland as well as in other organs. This substance is involved in many ocular functions, giving its synthesis in numerous eye structures. Melatonin is synthesized from serotonin through two enzymes, the first

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service