Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTGAGGCTGCCCACACTACCGGCCCCACAGGCAGTGCGCCCAACAGCCCCATGGCGCTGCTCACCATCGGGTCCAGCTCAGAGAAGGAGATTGATGATGTCATTGATGAGATCATCAGCCTGGAGTCCAGTTACAATGATGAAATGCTCAGCTATCTGCCCGGAGGCACCACAGGACTGCAGCTCCCCAGCACGCTGCCTGTGTCAGGGAATCTGCTTGATGTGTACAGTAGTCAAGGCGTGGCCACACCAGCCATCACTGTCAGCAACTCCTGCCCAGCTGAGCTGCCCAACATCAAACGGGAGATCTCTGAGACCGAGGCAAAGGCCCTTTTGAAGGAACGGCAGAAGAAAGACAATCACAACCTAATTGAGCGTCGCAGGCGATTCAACATTAACGACAGGATCAAGGAACTGGGCACTCTCATCCCTAAGTCCAGTGACCCGGAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... TFE3(7030)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Nunzia Pastore et al.
The EMBO journal, 38(12) (2019-05-28)
Autophagy and energy metabolism are known to follow a circadian pattern. However, it is unclear whether autophagy and the circadian clock are coordinated by common control mechanisms. Here, we show that the oscillation of autophagy genes is dependent on the
Leeanna El-Houjeiri et al.
Cell reports, 26(13), 3613-3628 (2019-03-28)
TFEB and TFE3 are transcriptional regulators of the innate immune response, but the mechanisms regulating their activation upon pathogen infection are poorly elucidated. Using C. elegans and mammalian models, we report that the master metabolic modulator 5'-AMP-activated protein kinase (AMPK) and
Chuanbin Yang et al.
Redox biology, 32, 101445-101445 (2020-02-11)
TFEB (transcription factor EB) and TFE3 (transcription factor E3) are "master regulators" of autophagy and lysosomal biogenesis. The stress response p38 mitogen-activated protein (MAP) kinases affect multiple intracellular responses including inflammation, cell growth, differentiation, cell death, senescence, tumorigenesis, and autophagy.
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU157921-50UG | 04061828419418 |
| EHU157921-20UG | 04061828644278 |