Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GAGGTGCCTAGCTTGGTGAGGTTACTCCTGCTCCTCCAACCTTTTTTTGCCAAGGTTTGTACACGACTCCCATCTAGGCTGAAAACCTAGAAGTGGACCTTGTGTGTGTGCATGGTGTCAGCCCAAAGCCAGGCTGAGACAGTCCTCATATCCTCTTGAGCCAAACTGTTTGGGTCTCGTTGCTTCATGGTATGGTCTGGATTTGTGGGAATGGCTTTGCGTGAGAAAGGGGAGGAGAGTGGTTGCTGCCCTCAGCCGGCTTGAGGACAGAGCCTGTCCCTCTCATGACAACTCAGTGTTGAAGCCCAGTGTCCTCAGCTTCATGTCCAGTGGATGGCAGAAGTTCATGGGGTAGTGGCCTCTCAAAGGCTGGGCGCATCCCAAGACAGCCAGCAGGTTGTCTCTGGAAACGACCAGAGTTAAGCTCTCGGCTTCTCTGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PMEPA1(56937)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Riezki Amalia et al.
Cellular signalling, 59, 24-33 (2019-03-21)
Transmembrane prostate androgen-induced protein (TMEPAI) is a type I transmembrane protein induced by several intracellular signaling pathways such as androgen, TGF-β, EGF, and Wnt signaling. It has been reported that TMEPAI functions to suppress TGF-β and androgen signaling but here
Noboru Funakubo et al.
Journal of cellular physiology, 233(4), 3105-3118 (2017-08-13)
Osteoclasts are multinucleated cells formed by fusion of preosteoclasts (POCs) derived from cells of the monocyte/macrophage lineage. We have reported a culture system that supports the formation of POCs from stroma-depleted rat bone marrow cells. Global gene expression analysis of
Yuyin Li et al.
Cell proliferation, 49(6), 710-719 (2016-11-04)
TMEPAI (transmembrane prostate androgen-induced protein) has been reported to be overexpressed during tumour progression; however, little is known concerning transcriptional mechanisms regulating TMEPAI gene expression. In this study, the TMEPAI gene promoter has been identified and characterized, and the effects
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU158351-20UG | 04061828644575 |
| EHU158351-50UG | 04061828409969 |