Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AACTGGGGCAACCTTTTCTTCGCCTCTGCCTTTGCCTTCCTGGGGCTCTTGGCGCTGACAGTCACCTTTTCCTGCAACCTGGCCACCATTAAGGCCCTGGTGTCCCGCTGCCGGGCCAAGGCCACGGCATCTCAGTCCAGTGCCCAGTGGGGCCGCATCACGACCGAGACGGCCATTCAGCTTATGGGGATCATGTGCGTGCTGTCGGTCTGCTGGTCTCCGCTCCTGATAATGATGTTGAAAATGATCTTCAATCAGACATCAGTTGAGCACTGCAAGACACACACGGAGAAGCAGAAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PTGER3(5733)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Cristian Rodriguez-Aguayo et al.
EBioMedicine, 40, 290-304 (2019-01-19)
Inflammatory mediator prostaglandin E2-prostaglandin E2 receptor EP3 (PTGER3) signaling is critical for tumor-associated angiogenesis, tumor growth, and chemoresistance. However, the mechanism underlying these effects in ovarian cancer is not known. An association between higher tumoral expression of PTGER3 and shorter
Ju-Fang Liu et al.
Molecular cancer, 9, 43-43 (2010-02-25)
Cyclooxygenase (COX)-2, the inducible isoform of prostaglandin (PG) synthase, has been implicated in tumor metastasis. Interaction of COX-2 with its specific EP receptors on the surface of cancer cells has been reported to induce cancer invasion. However, the effects of
Yao Ye et al.
Journal of cancer research and clinical oncology, 146(9), 2189-2203 (2020-06-04)
Cervical cancer metastasis results in poor prognosis and increased mortality, which is not separated from inflammatory reactions accumulated by prostaglandin E2 (PGE2). As a specific G-protein coupled PGE2 receptor, EP3 is demonstrated as a negative prognosticator of cervical malignancy. Now
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU159061-20UG | 04061828645206 |
| EHU159061-50UG | 04061828420322 |