Sign In to View Organizational & Contract Pricing.
Select a Size
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGATCCACATCTGCGAAACCCTTTTCACCCCCAAGTGGCCCAGGGAGGTTTCCTGTGCCTTCTCCAGGCCACAGAAGTGGTCCCCCAGAGCCTCAGAGGAACCGAATGCCGCCCCCAAGGCCCGACGTGGGCTCAAAGCCTGATAGCATTCCTCCTCCAGTACCTAGTACTCCAAGACCCATTCAATCAAGTCCGCACAAC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Quality Level
Related Categories
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Wendan Yu et al.
Cell death & disease, 11(7), 506-506 (2020-07-08)
PD-L1 is overexpressed in tumor cells and contributes to cancer immunoevasion. However, the role of the tumor cell-intrinsic PD-L1 in cancers remains unknown. Here we show that PD-L1 regulates lung cancer growth and progression by targeting the WIP and β-catenin
Amrita Salvi et al.
Biochemical and biophysical research communications, 482(4), 1353-1359 (2016-12-13)
Cancer cell migration and invasion involves actin cytoskeleton reorganization, which is regulated by the WASP (Wiskott Aldrich Syndrome Protein) family of proteins such as WASP, N-WASP (Neural-WASP) and WASP interacting protein (WIP). In this study, we found that the expression
Yu Pan et al.
Journal of experimental & clinical cancer research : CR, 37(1), 167-167 (2018-07-26)
Aberrant expression of Wiskott-Aldrich syndrome protein interacting protein family member 1 (WIPF1) contributes to the invasion and metastasis of several malignancies. However, the role of WIPF1 in human pancreatic ductal adenocarcinoma (PDAC) remains poorly understood. Human pancreatic cancer samples from
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service