Skip to Content
Merck
CN

EHU159581

MISSION® esiRNA

targeting human WIPF1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGATCCACATCTGCGAAACCCTTTTCACCCCCAAGTGGCCCAGGGAGGTTTCCTGTGCCTTCTCCAGGCCACAGAAGTGGTCCCCCAGAGCCTCAGAGGAACCGAATGCCGCCCCCAAGGCCCGACGTGGGCTCAAAGCCTGATAGCATTCCTCCTCCAGTACCTAGTACTCCAAGACCCATTCAATCAAGTCCGCACAAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yu Pan et al.
Journal of experimental & clinical cancer research : CR, 37(1), 167-167 (2018-07-26)
Aberrant expression of Wiskott-Aldrich syndrome protein interacting protein family member 1 (WIPF1) contributes to the invasion and metastasis of several malignancies. However, the role of WIPF1 in human pancreatic ductal adenocarcinoma (PDAC) remains poorly understood. Human pancreatic cancer samples from
Wendan Yu et al.
Cell death & disease, 11(7), 506-506 (2020-07-08)
PD-L1 is overexpressed in tumor cells and contributes to cancer immunoevasion. However, the role of the tumor cell-intrinsic PD-L1 in cancers remains unknown. Here we show that PD-L1 regulates lung cancer growth and progression by targeting the WIP and β-catenin
Amrita Salvi et al.
Biochemical and biophysical research communications, 482(4), 1353-1359 (2016-12-13)
Cancer cell migration and invasion involves actin cytoskeleton reorganization, which is regulated by the WASP (Wiskott Aldrich Syndrome Protein) family of proteins such as WASP, N-WASP (Neural-WASP) and WASP interacting protein (WIP). In this study, we found that the expression

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service