Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGGTCCCCAGCTCCATAAGTCAGGAACAATCCAGGCAAGACGCGATCTACCAGAACCTGACCCAGCTTAAAGCTGCAGTGGGTGAGCTCTCAGAGAAATCCAAGCTGCAGGAGATCTACCAGGAGCTGACCCAGCTGAAGGCTGCAGTGGGTGAGCTTCCAGAGAAATCTAAGCTGCAGGAGATCTACCAGGAGCTGACCCGGCTGAAGGCTGCAGTGGGTGAGCTTCCAGAGAAATCTAAGCTGCAGGAGATCTACCAGGAGCTGACCTGGCTGAAGGCTGCAGTGGGTGAGCTTCCAGAGAAATCTAAGATGCAGGAGATCTACCAGGAGCTGACTCGGCTGAAGGCTGCAGTGGGTGAGCTTCCAGAGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CD209(30835)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yanmei Jiang et al.
PloS one, 9(12), e114748-e114748 (2014-12-17)
Colon cancer has always been diagnosed at a late stage, which is associated with poor prognosis. The currently used serum tumor markers CEA and CA19-9 display low sensitivity and specificity and may not have diagnostic value in early stage colon
Jian Wu et al.
Frontiers in immunology, 9, 1847-1847 (2018-08-29)
By shaping T cell immunity, tolerogenic dendritic cells (tDCs) play critical roles in the induction of immune tolerance after transplantation. However, the role of long noncoding RNAs (lncRNAs) in the function and immune tolerance of dendritic cells (DCs) is largely
Zoltan Beck et al.
PloS one, 8(11), e81002-e81002 (2013-11-28)
Chronic HIV-1 infection is associated with persistent viremia in most patients, but it remains unclear how free virus may survive the potential hostile effects of plasma. We investigated whether sites might exist on the surfaces of circulating blood cells for
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU159851-50UG | 04061828410651 |
| EHU159851-20UG | 04061831367805 |