Skip to Content
Merck
CN

EHU160521

Sigma-Aldrich

MISSION® esiRNA

targeting human SIRT2

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTGGGGAGCTCAGAACATCCCCCAATCTCTTACAGCTCCCTCCCCAAAACTGGGGTCCCAGCAACCCTGGCCCCCAACCCCAGCAAATCTCTAACACCTCCTAGAGGCCAAGGCTTAAACAGGCATCTCTACCAGCCCCACTGTCTCTAACCACTCCTGGGCTAAGGAGTAACCTCCCTCATCTCTAACTGCCCCCACGGGGCCAGGGCTACCCCAGAACTTTTAACTCTTCCAGGACAGGGAGCTTCGGGCCCCCACTCTGTCTCCTGCCCCCGGGGGCCTGTGGCTAAGTAAACCATACCTAACCTACCCCAGTGTGGGTGTGGGCCTCTGAATATAACCCACACCCAGCGTAGGGGGAGTCTGAGCCGGGAGGGCTCCCGAGTCTCTGCCTTCAGCTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ming Chen et al.
Cancer immunology, immunotherapy : CII, 68(6), 961-971 (2019-04-08)
Hepatocellular carcinoma (HCC) is the third most lethal cancer in the world. Natural killer (NK) cell-mediated immunity is crucial for tumor surveillance and therapy. Characterization of the regulatory mechanisms of NK cell function is important for developing novel immunotherapies against
Fang-Fang He et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 46(2), 451-460 (2018-04-04)
Renal tubular epithelial cells and fibroblasts are the main sources of myofibroblasts, and these cells produce the extracellular matrix during tubulointerstitial fibrosis (TIF). Histone deacetylases (HDAC) inhibitors exert an antifibrogenic effect in the skin, liver and lung. Sirtuin 2 (SIRT2)
Phuongmai Nguyen et al.
Radiation research, 191(5), 398-412 (2019-03-06)
Sirtuin 2 (SIRT2) plays a major role in aging, carcinogenesis and neurodegeneration. While it has been shown that SIRT2 is a mediator of stress-induced cell death, the mechanism remains unclear. In this study, we report the role of SIRT2 in
Chin-Wei Liu et al.
Chemico-biological interactions, 289, 98-108 (2018-04-22)
Breast cancer is a major public health problem throughout the world. In this report, we investigated whether CHM-1, a novel synthetic antimitotic agent could be developed into a potent antitumor agent for treating human breast cancer. CHM-1 induced growth inhibition
Savita Bhalla et al.
Cancer biology & therapy, 17(3), 300-309 (2016-01-23)
Sirtuins (SIRT) are nicotinamide adenine dinucleotide (NAD+) dependent deacetylases or ADP- ribosyl transferases (ARTs) that deacetylate lysine residues on various proteins regulating a variety of cellular and metabolic processes. These enzymes regulate metabolism, cell survival, differentiation and DNA repair. SIRT

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service