Skip to Content
Merck
CN

EHU161031

Sigma-Aldrich

MISSION® esiRNA

targeting human RET

Sign Into View Organizational & Contract Pricing

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTGCATGAGAACAACTGGATCTGCATCCAGGAGGACACCGGCCTCCTCTACCTTAACCGGAGCCTGGACCATAGCTCCTGGGAGAAGCTCAGTGTCCGCAACCGCGGCTTTCCCCTGCTCACCGTCTACCTCAAGGTCTTCCTGTCACCCACATCCCTTCGTGAGGGCGAGTGCCAGTGGCCAGGCTGTGCCCGCGTATACTTCTCCTTCTTCAACACCTCCTTTCCAGCCTGCAGCTCCCTCAAGCCCCGGGAGCTCTGCTTCCCAGAGACAAGGCCCTCCTTCCGCATTCGGGAGAACCGACCCCCAGGCACCTTCCACCAGTTCCGCCTGCTGCCTGTGCAGTTCTTGTGCCCCAACATCAGCGTGGCCTACAGGCTCCTGGAGGGTGAGGGTCTGCCCTTCCGCTGCGCCCCGGACAGCCTGGAGGTGAGCACGCGCTGGGCCCTGGACCGCGAGCAGCGGGAGAAGTACGAGCTGGTGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RET(5979), RET(5979)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Kaustubh Bhinge et al.
Oncotarget, 8(16), 27155-27165 (2017-05-04)
Achaete-scute homolog 1 (ASCL1) is a neuroendocrine transcription factor specifically expressed in 10-20% of lung adenocarcinomas (AD) with neuroendocrine (NE) differentiation (NED). ASCL1 functions as an upstream regulator of the RET oncogene in AD with high ASCL1 expression (A+AD). RET
Hoon Ryu et al.
Laboratory investigation; a journal of technical methods and pathology, 91(3), 342-352 (2011-02-02)
Amyotrophic lateral sclerosis (ALS) is a fatal neurological disorder characterized by selective degeneration of motor neurons throughout the central nervous systems. Non-cell autonomous damage induced by glial cells is linked to the selective susceptibility of motor neurons in ALS, but
N Narita et al.
Oncogene, 28(34), 3058-3068 (2009-06-30)
RET proto-oncogene encodes a receptor tyrosine kinase whose ligand is glial cell line-derived neurotrophic factor (GDNF), and its polymorphism at G691S juxtamembrane region (RETp) is a germline polymorphism. Cutaneous melanomas, particularly the desmoplastic subtype, are highly neurotropic; thus we sought

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service