EMU005041
MISSION® esiRNA
targeting mouse Fbxw7
Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGTGGAATGCTGAAACTGGAGAGTGTATACATACTTTATATGGGCACACTTCTACTGTACGGTGTATGCATCTCCATGAAAAAAGGGTTGTAAGCGGTTCTCGAGATGCCACTCTCAGGGTTTGGGATATTGAGACCGGCCAGTGTTTACACGTCCTGATGGGTCACGTAGCAGCGGTCCGCTGCGTTCAGTATGATGGCAGGAGGGTTGTTAGTGGAGCTTATGATTTTATGGTGAAGGTGTGGGATCCAGAGACTGAGACCTGTCTACACACGTTACAGGGACACACTAATAGAGTCTATTCATTACAGTTTGATGGCATCCATGTGGTGAGTGGATCTCTTGATACATCAATCCGAGTCTGGGATGTGGAGACAGGGAATTGTATTCACACGCTAACAGGACACC
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... FBXW7(50754), Fbxw7(50754)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Kangsheng Tu et al.
Molecular cancer, 13, 110-110 (2014-06-03)
The E3 ubiquitin ligase Fbxw7 functions as a general tumor suppressor by targeting several well-known oncoproteins for ubiquitination and proteasomal degradation. However, the clinical significance of Fbxw7 and the mechanisms involved in the anti-cancer effect of Fbxw7 in HCC are
Xiaoying Zhou et al.
Journal of experimental & clinical cancer research : CR, 34, 28-28 (2015-04-19)
Increasing evidence showed that miRNAs serve as modulators of human cancer, either as oncogene or tumor suppressors. Cisplatin resistance is the most common cause of chemotherapy failure in gastric cancer (GC). However, the roles of miRNAs in cisplatin resistance of
Junghui Koo et al.
The Journal of biological chemistry, 290(22), 14120-14129 (2015-04-22)
Rictor, an essential component of mTOR complex 2 (mTORC2), plays a pivotal role in regulating mTOR signaling and other biological functions. Posttranslational regulation of rictor (e.g. via degradation) and its underlying mechanism are largely undefined and thus are the focus
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU005041-50UG | 04061828430918 |
| EMU005041-20UG | 04061828656196 |