Skip to Content
Merck
CN

EMU009181

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ly6a

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCAGTCCTCCTGCAGACCTTGCTCTGATGGTCCTCCCAATGACCTCCACCCTTGTCCTTTTATCCTCATGTGCAACAATTCTTCCTGGAGCCCTCTAGTGATGAATTATGAGTTATAGAAGCTCCAAGGTGGGAGTAGTGTGTGAAATACCATGTTTTGCCTTTATAGCCCCTGCTGGGTAGGTAGGTGCTCTAATCCTCTCTAGGGCTTTCAAGTCTGTACTTCCTAGAATGTCATTTTGTTGTGGATTGCTGCTCATGACCCTGGAGGCACACAGCCAGCACAGTGAAGAGGCAGAATTCCAAGGTATTATGCTATCACCATCCACACATAAGTATCTGGGGTCCTGCAATGTTCCCACATGTATCCTGAATGTCCCCCTGTTGAGTCCAATAAACCCTTTGTTCTCCCAAAA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yu-Chiao Hsu et al.
PloS one, 9(2), e88966-e88966 (2014-03-04)
Stem cell antigen-1 (Ly6a/Sca-1) is a gene that is expressed in activated lymphocytes, hematopoietic stem cells and stem cells of a variety of tissues in mice. Despite decades of study its functions remain poorly defined. These studies explored the impact
Xiaohua Jia et al.
BMC nephrology, 13, 105-105 (2012-09-12)
Bone marrow (BM) stem cells have been reported to contribute to tissue repair after kidney injury model. However, there is no direct evidence so far that BM cells can trans-differentiate into renal stem cells. To investigate whether BM stem cells
Hao Wang et al.
BMC biotechnology, 14, 75-75 (2014-08-12)
Myocardial infarction remains the leading cause of mortality in developed countries despite recent advances in its prevention and treatment. Regenerative therapies based on resident cardiac progenitor cells (CPCs) are a promising alternative to conventional treatments. However, CPCs resident in the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service