EMU009181
MISSION® esiRNA
targeting mouse Ly6a
Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCAGTCCTCCTGCAGACCTTGCTCTGATGGTCCTCCCAATGACCTCCACCCTTGTCCTTTTATCCTCATGTGCAACAATTCTTCCTGGAGCCCTCTAGTGATGAATTATGAGTTATAGAAGCTCCAAGGTGGGAGTAGTGTGTGAAATACCATGTTTTGCCTTTATAGCCCCTGCTGGGTAGGTAGGTGCTCTAATCCTCTCTAGGGCTTTCAAGTCTGTACTTCCTAGAATGTCATTTTGTTGTGGATTGCTGCTCATGACCCTGGAGGCACACAGCCAGCACAGTGAAGAGGCAGAATTCCAAGGTATTATGCTATCACCATCCACACATAAGTATCTGGGGTCCTGCAATGTTCCCACATGTATCCTGAATGTCCCCCTGTTGAGTCCAATAAACCCTTTGTTCTCCCAAAA
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... LY6A(110454), Ly6a(110454)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yu-Chiao Hsu et al.
PloS one, 9(2), e88966-e88966 (2014-03-04)
Stem cell antigen-1 (Ly6a/Sca-1) is a gene that is expressed in activated lymphocytes, hematopoietic stem cells and stem cells of a variety of tissues in mice. Despite decades of study its functions remain poorly defined. These studies explored the impact
Xiaohua Jia et al.
BMC nephrology, 13, 105-105 (2012-09-12)
Bone marrow (BM) stem cells have been reported to contribute to tissue repair after kidney injury model. However, there is no direct evidence so far that BM cells can trans-differentiate into renal stem cells. To investigate whether BM stem cells
Hao Wang et al.
BMC biotechnology, 14, 75-75 (2014-08-12)
Myocardial infarction remains the leading cause of mortality in developed countries despite recent advances in its prevention and treatment. Regenerative therapies based on resident cardiac progenitor cells (CPCs) are a promising alternative to conventional treatments. However, CPCs resident in the
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU009181-20UG | 04061831368475 |
| EMU009181-50UG | 04061828438969 |