Skip to Content
Merck
CN

EMU010191

MISSION® esiRNA

targeting mouse Gper

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTACCTAGGTCCCGTGTGGCCAGCCCCTTCCAACAGCACCCCTCTGGCCCTCAACTTGTCCCTGGCACTGCGGGAAGATGCCCCGGGGAACCTCACTGGGGACCTCTCTGAGCATCAGCAGTACGTGATTGCCCTCTTCCTCTCCTGCCTCTACACCATCTTCCTCTTTCCTATTGGCTTTGTGGGCAACATCCTCATCCTGGTGGTGAACATCAGCTTCCGGGAGAAGATGACCATCCCAGACCTGTACTTCATCAACCTGGCGGCGGCCGACCTCATCCTGGTGGCTGACTCCCTGATTGAGGTGTTCAACCTGGACGAGCAGTACTACGACATCGCAGTGCTCTGCACCTTCATGTCCCTCTTCCTGCAGATCAACATGTACAGCAGCGTCTTCTTCCTCACCTGGATGAGCTT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Rainer Girgert et al.
Breast cancer research and treatment, 134(1), 199-205 (2012-02-01)
Triple-negative breast cancers lack estrogen receptor α (ERα), progesterone receptor, and do not overexpress human epidermal growth factor receptor 2 (Her-2). They are neither susceptible to endocrine therapy nor to a therapy using the anti-Her-2 antibody, trastuzumab. Therefore, an efficient
Whitney K Petrie et al.
Obstetrics and gynecology international, 2013, 472720-472720 (2014-01-01)
Endometrial carcinoma is the most common cancer of the female reproductive tract. GPER/GPR30 is a 7-transmembrane spanning G protein-coupled receptor that has been identified as the third estrogen receptor, in addition to ERα and ERβ. High GPER expression is predictive
Nicolas Chevalier et al.
PloS one, 7(4), e34672-e34672 (2012-04-13)
Testicular germ cell tumours are the most frequent cancer of young men with an increasing incidence all over the world. Pathogenesis and reasons of this increase remain unknown but epidemiological and clinical data have suggested that fetal exposure to environmental
Q K Y Chan et al.
Cell death and differentiation, 17(9), 1511-1523 (2010-03-06)
G-protein-coupled receptor-30 (GPR30) shows estrogen-binding affinity and mediates non-genomic signaling of estrogen to regulate cell growth. We here showed for the first time, in contrast to the reported promoting action of GPR30 on the growth of breast and ovarian cancer
Wenqing Cao et al.
PloS one, 7(12), e52838-e52838 (2013-01-04)
Although evidence has shown the regulating effect of n-3 poly-unsaturated fatty acid (n-3 PUFA) on cell signaling transduction, it remains unknown whether n-3 PUFA treatment modulates estrogen signaling. The current study showed that docosahexaenoic acid (DHA, C22:6), eicosapentaenoic acid (EPA

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service