Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AAGAGCGGACCTTCAGGAATTGGATGAACTCCCTGGGCGTTAACCCGCGCGTCAATCACTTGTACAGTGACTTATCGGATGCCTTAGTCATCTTCCAGCTCTATGAGAAGATCAAAGTCCCTGTTGATTGGAACAGAGTAAACAAGCCTCCATACCCCAAGCTGGGGGGCAATATGAAAAAGCTGGAGAACTGTAATTATGCAGTGGACCTGGGGAAGAATCAAGCTAAATTCTCCCTGGTTGGCATCGCAGGACAAGACCTCAATGAAGGAAACCGAACTCTCACGCTGGCATTGGTTTGGCAGCTCATGAGAAGGTACACACTGAATATCCTGGAAGATATCGGAGGTGGACAGAAGGTCAATGATGACATTATTGTCAACTGGGTGAATACGACCTTGAAGGAGGCACAGAAAAGCTCA
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... LCP1(18826), Lcp1(18826)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ping-Ping He et al.
Biochimie, 106, 81-90 (2014-08-26)
Accumulating evidence suggests that microRNA-590 (miR-590) has protective effects on cardiovascular diseases, but the mechanism is unknown. Interestingly, previous studies from our laboratory and others have shown that macrophage-derived lipoprotein lipase (LPL) might accelerate atherosclerosis by promoting lipid accumulation and
Majib Jan et al.
Biochemical and biophysical research communications, 462(1), 33-37 (2015-05-02)
In previous studies, we demonstrated that down-regulation of lipoprotein lipase in L6 muscle cells increased insulin-stimulated glucose uptake. In the current study, we used RNA interference technology to silence the LPL gene in L6 cells and generate a LPL-knock-down (LPL-KD)
Uri Rozovski et al.
Molecular cancer research : MCR, 13(5), 944-953 (2015-03-04)
While reviewing chronic lymphocytic leukemia (CLL) bone marrow slides, we identified cytoplasmic lipid vacuoles in CLL cells but not in normal B cells. Because lipoprotein lipase (LPL), which catalyzes hydrolysis of triglycerides into free fatty acids (FFA), is aberrantly expressed
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU011931-20UG | 04061828472369 |
| EMU011931-50UG | 04061828247066 |