Skip to Content
Merck
CN

EMU013421

MISSION® esiRNA

targeting mouse Cdkn1a

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGTGGAACTTTGACTTCGTCACGGAGACGCCGCTGGAGGGCAACTTCGTCTGGGAGCGCGTTCGGAGCCTAGGGCTGCCCAAGGTCTACCTGAGCCCTGGGTCCCGCAGCCGTGACGACCTGGGAGGGGACAAGAGGCCCAGTACTTCCTCTGCCCTGCTGCAGGGGCCAGCTCCGGAGGACCACGTGGCCTTGTCGCTGTCTTGCACTCTGGTGTCTGAGCGGCCTGAAGATTCCCCGGGTGGGCCCGGAACATCTCAGGGCCGAAAACGGAGGCAGACCAGCCTGACAGATTTCTATCACTCCAAGCGCAGATTGGTCTTCTGCAAGAGAAAACCCTGAAGTGCCCACGGGAGCCCCGCCCTCTTCTGCTGTGGGTCAGGAGGCCTCTTCCCCATCTTCGGCCTTAGCCCTCACTCTGTGTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Rosaura Esteve-Puig et al.
PLoS genetics, 10(10), e1004721-e1004721 (2014-10-21)
Exposure to ultraviolet (UV) radiation from sunlight accounts for 90% of the symptoms of premature skin aging and skin cancer. The tumor suppressor serine-threonine kinase LKB1 is mutated in Peutz-Jeghers syndrome and in a spectrum of epithelial cancers whose etiology
Desheng Zhong et al.
Journal of cellular biochemistry, 115(9), 1624-1635 (2014-05-03)
Pan-Bcl-2 family inhibitor obatoclax has been demonstrated to be effective against various cancers, of which the mechanism of action is not fully understood. In this study, we demonstrate that obatoclax suppressed esophageal cancer cell viability with concomitant G1/G0-phase cell cycle

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service