Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCAGCCTAACAGTCCCAGTGAATATTGCTTTGATGTGGATAGCGATATGGTCAATGTATTCAAGTTGGAACTGGTGGAAAAACTGTTTGCTGAAGACACAGAGGCAAAGAATCCATTTTCAACTCAGGACACTGATTTAGATTTGGAGATGCTGGCTCCCTATATCCCAATGGATGATGATTTCCAGTTACGTTCCTTTGATCAGTTGTCACCATTAGAGAGCAATTCTCCAAGCCCTCCAAGTATGAGCACAGTTACTGGGTTCCAGCAGACCCAGTTACAGAAACCTACCATCACTGCCACTGCCACCACAACTGCCACCACTGATGAATCAAAAACAGAGACGAAGGACAATAAAGAAGATATTAAAATACTGATTGCATCTCCATCTTCTACCCAAGTACCTCAAGAAACGACCACTGCTAAGGC
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... HIF1A(15251), Hif1a(15251)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Qianqian Gao et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 74, 57-62 (2015-09-10)
A major cause of morbidity and mortality in cardiovascular disease is pathological cardiac hypertrophy. With an increase in the cellular surface area and upregulation of the atrial natriuretic peptide (ANP) gene, cardiac hypertrophy is a prominent feature of diabetic cardiomyopathy.
Yong Zhang et al.
Science translational medicine, 7(290), 290ra92-290ra92 (2015-06-05)
Whereas amphibians regenerate lost appendages spontaneously, mammals generally form scars over the injury site through the process of wound repair. The MRL mouse strain is an exception among mammals because it shows a spontaneous regenerative healing trait and so can
Naoki Adachi et al.
Biochemical and biophysical research communications, 463(4), 1176-1183 (2015-06-19)
Poor survival is a major problem of adipocyte transplantation. We previously reported that VEGF and MMPs secreted from transplanted adipocytes are essential for angiogenesis and adipogenesis. Pretreatment with low-dose (5 Gy) radiation (LDR) increased VEGF, MMP-2, and HIF-1 alpha mRNA expression
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU015451-50UG | 04061828237357 |
| EMU015451-20UG | 04061831337723 |