Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGGACGTTTCACACAGTGGTATTTCGGCGCCTACTCTATCGCTGCAGGTGTGCTCATCTGTCTGCTGGAGTATCCCCGGGGAAAGAGGAAAAAGGGGTCCACCATGGAGCGATGTGGACAGAAGTACCTGACCCCTGTGGTGAAGCTTTTCGGGCCCCTCACCAGGAATTACTACGTCCGGGCTGCCCTCCACTTCCTGTTGTCGGTGCCTGCAGGCTTCCTCCTGGCCACCATCCTGGGGACCGTCTGCTTGGCCATTGCCAGTGTGATCTATCTGCTGGCAGCCATCCGAGGTGAGCAGTGGACTCCCATTGAGCCTAAACCCAAGGAGCGGCCACAGGTTGGAGGCACCATCAAGCAACCACCTACCAACCCCCCACCCCGGCCACCCGCAGAGGTCCGAAAGAAGCCGAGTGAGGGTGAAGAGGAG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... CYBA(13057), Cyba(13057)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Rui Yamaguchi et al.
Blood cells, molecules & diseases, 57, 85-90 (2016-02-09)
Granulocyte-macrophage colony stimulating factor (GM-CSF) induces procoagulant activity of macrophages. Tissue factor (TF) is a membrane-bound glycoprotein and substance P (SP) is a pro-inflammatory neuropeptide involved in the formation of membrane blebs. This study investigated the role of SP in
Young-Hoon Lee et al.
FEBS letters, 588(17), 3251-3258 (2014-07-30)
The expression of phospholipase D1 (PLD1) and PLD2 were found to decrease at the transcription level during both replicative and premature senescence in human lung fibroblast IMR-90 cells. Knockdown of PLD2 dramatically induced senescent phenotype in proliferating IMR-90 cells and
Jessica M Overstreet et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 29(4), 1258-1268 (2014-12-07)
Effective therapy to prevent organ fibrosis, which is associated with more than half of all mortalities, remains elusive. Involvement of tumor suppressor ataxia telangiectasia mutated (ATM) in the TGF-β1 pathway related to renal fibrosis is largely unknown. ATM activation (pATM(Ser1981))
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU015681-50UG | 04061828227389 |
| EMU015681-20UG | 04061828461134 |