Skip to Content
Merck
CN

EMU015681

MISSION® esiRNA

targeting mouse Cyba

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting mouse Cyba

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGACGTTTCACACAGTGGTATTTCGGCGCCTACTCTATCGCTGCAGGTGTGCTCATCTGTCTGCTGGAGTATCCCCGGGGAAAGAGGAAAAAGGGGTCCACCATGGAGCGATGTGGACAGAAGTACCTGACCCCTGTGGTGAAGCTTTTCGGGCCCCTCACCAGGAATTACTACGTCCGGGCTGCCCTCCACTTCCTGTTGTCGGTGCCTGCAGGCTTCCTCCTGGCCACCATCCTGGGGACCGTCTGCTTGGCCATTGCCAGTGTGATCTATCTGCTGGCAGCCATCCGAGGTGAGCAGTGGACTCCCATTGAGCCTAAACCCAAGGAGCGGCCACAGGTTGGAGGCACCATCAAGCAACCACCTACCAACCCCCCACCCCGGCCACCCGCAGAGGTCCGAAAGAAGCCGAGTGAGGGTGAAGAGGAG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Rui Yamaguchi et al.
Blood cells, molecules & diseases, 57, 85-90 (2016-02-09)
Granulocyte-macrophage colony stimulating factor (GM-CSF) induces procoagulant activity of macrophages. Tissue factor (TF) is a membrane-bound glycoprotein and substance P (SP) is a pro-inflammatory neuropeptide involved in the formation of membrane blebs. This study investigated the role of SP in
Jessica M Overstreet et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 29(4), 1258-1268 (2014-12-07)
Effective therapy to prevent organ fibrosis, which is associated with more than half of all mortalities, remains elusive. Involvement of tumor suppressor ataxia telangiectasia mutated (ATM) in the TGF-β1 pathway related to renal fibrosis is largely unknown. ATM activation (pATM(Ser1981))
Young-Hoon Lee et al.
FEBS letters, 588(17), 3251-3258 (2014-07-30)
The expression of phospholipase D1 (PLD1) and PLD2 were found to decrease at the transcription level during both replicative and premature senescence in human lung fibroblast IMR-90 cells. Knockdown of PLD2 dramatically induced senescent phenotype in proliferating IMR-90 cells and
Chih-Chang Hung et al.
Oncotarget, 6(6), 4110-4125 (2015-02-18)
Cisplatin (CDDP) is a potent chemotherapeutic agent but resistance to the drug remains a major challenge in cancer treatment. To evaluate the efficacy of CDDP in oral squamous cell carcinoma (OSCC), we found that p22phox was highly expressed in CDDP-resistant

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service