Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGCGTTAAGCAGGAACTGGAAGAGAAGGAGAATTGTCACCTGGAGCAGAATCGGGTTAAGGTTGAGGAGCCCTCAGGAGTGTCAACATCTTGGCAGGACTCTGTGTCTGAGAGGCCACCCTACTCTTATATGGCCATGATACAGTTTGCCATCAACAGCACTGAGAGAAAGCGCATGACCTTGAAGGACATCTACACTTGGATTGAGGACCACTTCCCTTACTTTAAGCACATTGCCAAGCCAGGCTGGAAGAACTCTATTCGTCACAACCTTTCTCTCCATGACATGTTTGTTCGAGAGACATCTGCCAATGGCAAGGTCTCCTTCTGGACCATTCACCCAAGTGCCAATCGCTACTTGACATTGGACCAAGTGTTTAAGCCACTGGAACCAGGGTCTCCACAATCGCCCGAGCACTTGGAATCACAGCA
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... FOXM1(14235), Foxm1(14235)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
KanKan Yang et al.
Journal of experimental & clinical cancer research : CR, 34, 40-40 (2015-05-04)
The Forkhead box M1 (FOXM1) is an oncogenic transcription factor and plays a significant role in cell EMT, proliferation, metastasis in a multitude of human solid tumors including colorectal cancer (CRC). However, the underlying molecular mechanisms by which FoxM1 contributes
Xiaoxiao Li et al.
Journal of translational medicine, 11, 204-204 (2013-09-06)
Forkhead box transcription factor 1 (FOXM1) has been reported to overexpress and correlate with pathogenesis in a variety of human malignancies. However, little research has been done to investigate its clinical significance in gastric cancer. We examined the expression of
Satoru Inoguchi et al.
FEBS letters, 588(17), 3170-3179 (2014-07-08)
Here, we found that microRNA-24-1 (miR-24-1) is significantly reduced in bladder cancer (BC) tissues, suggesting that it functions as a tumour suppressor. Restoration of mature miR-24-1 inhibits cancer cell proliferation and induces apoptosis. Forkhead box protein M1 (FOXM1) is a
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU016141-50UG | 04061828227785 |
| EMU016141-20UG | 04061831337808 |