Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGGATGGGTTACTGCCTCTTCTACGAGTCCATGCTCAACACCGTGCTGCACGCTCGGGACAAGTGGCTGGCACCCGATGGCCTCATCTTCCCAGACCGGGCCACCTTGTATGTGACAGCCATTGAGGACCGACAATATAAAGACTACAAGATCCACTGGTGGGAGAACGTGTATGGCTTTGATATGTCCTGCATTAAAGACGTGGCCATCAAGGAGCCCCTGGTGGACGTGGTGGACCCAAAGCAGCTGGTCACCAATGCCTGCCTCATAAAGGAGGTGGACATTTACACAGTCAAGGTGGAGGACCTGACCTTCACCTCCCCCTTCTGCCTGCAAGTGAAGAGGAACGACTACGTGCACGCGCTGGTGGCTTACTTCAACATCGAGTTCACCCGATGCCACAAGAGGACCGGCTTCTCCACCAGTCCTGAG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... PRMT1(15469), Prmt1(15469)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Sreedevi Avasarala et al.
The Journal of biological chemistry, 290(21), 13479-13489 (2015-04-08)
Protein arginine methyl transferase 1 (PRMT1) was shown to be up-regulated in cancers and important for cancer cell proliferation. However, the role of PRMT1 in lung cancer progression and metastasis remains incompletely understood. In the present study, we show that
Bingshou Li et al.
Biochemical and biophysical research communications, 464(4), 982-987 (2015-07-15)
Accumulating evidence indicates that microRNAs function as oncogenes or tumor suppressor genes in human cancer. MiR-503 is deregulated in various human cancers and has been associated with hepatocellular carcinoma (HCC) progression. However, the underlying mechanisms of miR-503 involvement in the
Dong-Il Kim et al.
Oxidative medicine and cellular longevity, 2015, 617919-617919 (2015-11-20)
Oxidative stress-induced retinal pigment epithelial (RPE) cell damage is involved in the progression of diabetic retinopathy. Arginine methylation catalyzed by protein arginine methyltransferases (PRMTs) has emerged as an important histone modification involved in diverse diseases. Sirtuin (SIRT1) is a protein
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU016791-50UG | 04061831368796 |
| EMU016791-20UG | 04061831337860 |