Skip to Content
Merck
CN

EMU023001

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Irf8

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATCGAACAGATCGACAGCAGCATGTACCCGGGGCTGATCTGGGAAAATGATGAGAAGACCATGTTCCGTATCCCCTGGAAGCATGCCGGCAAGCAGGATTACAATCAGGAGGTGGATGCTTCCATCTTCAAGGCCTGGGCAGTTTTTAAAGGGAAGTTTAAAGAGGGAGACAAAGCTGAACCAGCCACGTGGAAGACGAGGTTACGCTGTGCTCTGAACAAGAGCCCAGATTTTGAAGAAGTGACTGACCGGTCCCAGCTGGACATTTCTGAGCCATATAAAGTTTACCGAATTGTCCCCGAGGAAGAACAAAAATGCAAGCTGGGCGTGGCACCTGCAGGCTGCATGAGCGAAGTTCCTGAGATGGAGTGTGGCCGCTCAGAGATTGAGGAGCTGATCAAGGAACCTTCTGTGGATGAGTACATGGGTATGACCAAGAGGAGCCCA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ji-Ye Kee et al.
BMC cancer, 14, 949-949 (2014-12-17)
Inhibition of metastasis through upregulation of immune surveillance is a major purpose of chemokine gene therapy. In this study, we focused on a membrane-bound chemokine CXCL16, which has shown a correlation with a good prognosis for colorectal cancer (CRC) patients.
Chunyuan Guo et al.
Kidney international, 92(5), 1194-1205 (2017-07-16)
DNA methylation is an epigenetic mechanism that regulates gene transcription without changing primary nucleotide sequences. In mammals, DNA methylation involves the covalent addition of a methyl group to the 5-carbon position of cytosine by DNA methyltransferases (DNMTs). The change of
Takuya Yashiro et al.
Scientific reports, 9(1), 1161-1161 (2019-02-06)
The chemokine CCL22 is predominantly produced by dendritic cells (DCs) and macrophages. CCL22 acts on CCR4-expressing cells including Th2 and Treg. Although a correlation between the CCL22-CCR4 axis and allergic diseases has been established, the mechanism of monocyte lineage-specific Ccl22
Makoto Horiuchi et al.
Journal of neuroinflammation, 8, 8-8 (2011-01-26)
Administration of exogenous interferon-γ (IFNγ) aggravates the symptoms of multiple sclerosis (MS), whereas interferon-β (IFNβ) is used for treatment of MS patients. We previously demonstrated that IFNγ induces apoptosis of oligodendroglial progenitor cells (OPCs), suggesting that IFNγ is more toxic

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service