Skip to Content
Merck
CN

EMU024721

MISSION® esiRNA

targeting mouse Wnt1

Sign In to View Organizational & Contract Pricing.

Select a Size

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324

Key Documents

View All Documentation
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting mouse Wnt1

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCGTTCTGCACGAGTGTCTATGAGGTGCCGCGCCTCCGGGAACGGGAACGCTCTCTTCCAGTTCTCAGACACACTCACTGGTCCTGATGTTTGCCCACCCTACCGCGTCCAGCCACAGTCCCAGGGTTCATAGCGATCCATCTCTCCCACCTCCTACCTGGGGACTCCTGAAACCACTTGCCTGAGTCGGCTCGAACCCTTTTGCCATCCTGAGGGCCCTGACCCAGCCTACCTCCCTCCCTCTTTGAGGGAGACTCCTTTTGCACTGCCCCCCAATTTGGCCAGAGGGTGAGAGAAAGATTCTTCTTCTGGGGTGGGGGTGGGGAGGTCAACTCTTGAAGGTGTTGCGGTTCCTGATGTATTTTGCGCTGTGACCTCTTTGGGTATTATCACCTTTCCTTGTCTCTCAGGTCCCTATAGGTCCCTTGAGTTCTCTAACCAGCACCTCTGGG

Ensembl | mouse accession no.

ENSMUSG00000022997

NCBI accession no.

NM_021279

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

mouse ... WNT1(22408), Wnt1(22408)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
UZU
AOR

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Nithidol Sakunrangsit et al.
Pharmacological research, 150, 104517-104517 (2019-11-07)
Fifty percent of advanced stage ER-positive breast cancer patients develop endocrine resistance. Aberrant activation of Wnt/β-catenin is associated with stem-like phenotypes and epithelial-mesenchymal transition (EMT) process which confers resistance to endocrine therapy. Cancer stem-like cells (CSLCs) can be a vital
Megan M Weivoda et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 31(1), 76-85 (2015-06-26)
Osteoblast-mediated bone formation is coupled to osteoclast-mediated bone resorption. These processes become uncoupled with age, leading to increased risk for debilitating fractures. Therefore, understanding how osteoblasts are recruited to sites of resorption is vital to treating age-related bone loss. Osteoclasts
Han Yan et al.
Molecular carcinogenesis, 53(12), 960-969 (2013-07-19)
The epithelial-mesenchymal transition (EMT) and acquisition of cancer stem cells (CSCs)-like properties are essential steps in the metastasis and postsurgical recurrence of hepatocellular carcinomas (HCCs). The molecular mechanisms involved, however, remain obscure. As determined by an miRNA microarray analysis, there
Jian Cao et al.
Prostaglandins & other lipid mediators, 116-117, 76-86 (2015-02-14)
Myocardial infarction (MI) is complicated by ventricular fibrosis and associated diastolic and systolic failure. Emerging studies implicate Wnt1 signaling in the formation of new blood vessels. Epoxyeicosatrienoic acids (EETs)-mediated up-regulation of heme oxygenase-1 (HO-1) protects against the detrimental consequences of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service