Skip to Content
Merck
CN

EMU026071

MISSION® esiRNA

targeting mouse Axl

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGGTACCGTGTCCGAAAGTCCTACAGCCGGCGGACCACTGAAGCCACCTTGAACAGTCTGGGCATCAGTGAAGAGCTGAAGGAGAAACTACGAGACGTCATGGTAGATCGGCATAAGGTGGCCTTGGGGAAGACCCTGGGAGAAGGAGAATTTGGCGCTGTGATGGAAGGTCAGCTCAATCAGGATGACTCCATCCTCAAGGTCGCTGTGAAGACCATGAAAATTGCCATCTGCACAAGATCAGAGCTGGAGGATTTCCTGAGTGAAGCTGTCTGCATGAAGGAATTTGACCACCCCAACGTCATGAGGCTCATTGGCGTCTGTTTTCAGGGCTCTGACAGAGAGGGTTTCCCAGAACCTGTGGTCATCTTGCCTTTCATGAAACACGGAGACCTACACAGTTTCCTCCTGTACTCCCGGCTCGGGGACCAGCCAGTGTTCCTGCCCACTCAGAT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Toni M Brand et al.
Cancer research, 74(18), 5152-5164 (2014-08-20)
The EGFR antibody cetuximab is used to treat numerous cancers, but intrinsic and acquired resistance to this agent is a common clinical outcome. In this study, we show that overexpression of the oncogenic receptor tyrosine kinase AXL is sufficient to
Catherine Wilson et al.
Cancer research, 74(20), 5878-5890 (2014-08-16)
Molecularly targeted drug therapies have revolutionized cancer treatment; however, resistance remains a major limitation to their overall efficacy. Epithelial-to-mesenchymal transition (EMT) has been linked to acquired resistance to tyrosine kinase inhibitors (TKI), independent of mutational resistance mechanisms. AXL is a
Rui Li et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(9), 7277-7283 (2015-04-22)
Increasing evidence has suggested that dysregulation of microRNAs (miRNAs) could contribute to tumor progression. The miR-34 family is directly transactivated by tumor suppressor p53 which is frequently mutated in various cancers; however, the effect of miR-34a on the ovarian cancer
Nam-Yi Kim et al.
International journal of oncology, 47(1), 353-360 (2015-05-16)
Metformin, the most frequently prescribed anti-diabetic drug, has recently been paid attention as a chemotherapeutic agent. In this study, we demonstrated that metformin decreased the viability of parental as well as cisplatin/taxol-resistant ovarian cancer cells. Its anti-proliferative effect was further

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service