Skip to Content
Merck
CN

EMU033181

MISSION® esiRNA

targeting mouse Btk

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTGAAGGAGCTTGGGACTGGACAATTCGGTGTCGTGAAATATGGGAAGTGGAGGGGCCAATATGATGTGGCCATCAAGATGATCAGAGAAGGTTCCATGTCGGAGGATGAATTCATTGAAGAAGCCAAAGTCATGATGAATCTTTCCCATGAGAAGCTGGTGCAGTTGTATGGCGTCTGCACCAAACAACGCCCCATCTTCATCATCACCGAGTACATGGCTAATGGCTGCCTCTTGAACTACCTGAGGGAGATGCGGCACCGCTTCCAGACACAGCAGCTGCTTGAGATGTGCAAAGATGTCTGTGAAGCAATGGAATACTTGGAGTCGAAGCAGTTCCTTCACAGAGACCTGGCAGCTCGAAACTGTTTGGTAAACGATCAAGGAGTTGTGAAAGTATCTGACTTTGGCCTGTCTAGGTATGTCCTTGATGATGAGTACACCAGCTCTGTAGGCTCCAAGTTTCCAGTTCGGTGGT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Agnieszka Krupa et al.
American journal of physiology. Lung cellular and molecular physiology, 307(6), L435-L448 (2014-08-03)
Previous observations made by our laboratory indicate that Bruton's tyrosine kinase (Btk) may play an important role in the pathophysiology of local inflammation in acute lung injury (ALI)/acute respiratory distress syndrome (ARDS). We have shown that there is cross talk
Angela Marina Montalbano et al.
European journal of pharmacology, 736, 35-43 (2014-05-07)
Cigarette smoke extract (CSE) affects the expression of Choline Acetyl-Transferase (ChAT), muscarinic acetylcholine receptors, and mucin production in bronchial epithelial cells. Mucin 5AC (MUC5AC), muscarinic acetylcholine receptor M3, ChAT expression, acetylcholine levels and acetylcholine binding were measured in a human
Genevra Pillinger et al.
Scientific reports, 5, 12949-12949 (2015-08-22)
Approximately 20% of patients with acute myeloid leukaemia (AML) have a mutation in FMS-like-tyrosine-kinase-3 (FLT3). FLT3 is a trans-membrane receptor with a tyrosine kinase domain which, when activated, initiates a cascade of phosphorylated proteins including the SRC family of kinases.
Neeraj Maurya et al.
Journal of immunology (Baltimore, Md. : 1950), 193(7), 3417-3425 (2014-08-31)
The receptor T cell Ig and mucin protein-3 (TIM-3) has emerged as an important regulator of innate immune responses. However, whether TIM-3-induced signaling promotes or inhibits the activation and maturation of dendritic cells (DCs) still remains uncertain. In addition, the
Panyu Zhou et al.
Cell biochemistry and biophysics, 70(2), 1265-1275 (2014-06-08)
Sepsis is a common and critical complication in surgical patients that often leads to multiple organ failure syndrome (MOFS), including acute lung injury (ALI) and acute respiratory distress syndrome (ARDS). Despite intensive supportive care and treatment modalities, the mortality of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service