Skip to Content
Merck
CN

EMU036931

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ccnd1

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCAGAAGTGCGAAGAGGAGGTCTTCCCGCTGGCCATGAACTACCTGGACCGCTTCCTGTCCCTGGAGCCCCTGAAGAAGAGCCGCCTGCAGCTGCTGGGGGCCACCTGCATGTTCGTGGCCTCTAAGATGAAGGAGACCATTCCCTTGACTGCCGAGAAGTTGTGCATCTACACTGACAACTCTATCCGGCCCGAGGAGCTGCTGCAAATGGAACTGCTTCTGGTGAACAAGCTCAAGTGGAACCTGGCCGCCATGACTCCCCACGATTTCATCGAACACTTCCTCTCCAAAATGCCAGAGGCGGATGAGAACAAGCAGACCATCCGCAAGCATGCACAGACCTTTGTGGCCCTCTGTGCCACAGATGTGAAGTTCATTTCCAACCCACCCTCCATGGTAGCTGCTGGGAGCGTGGTGGCTGCGATGCAAGGCCTGAACCTGGGCAGCCCCAACAACTTCCTCTCCTGCTACCGCACAACGCACTTTCTTTCCA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

B St Croix et al.
The Journal of cell biology, 142(2), 557-571 (1998-07-29)
Recent studies have demonstrated the importance of E-cadherin, a homophilic cell-cell adhesion molecule, in contact inhibition of growth of normal epithelial cells. Many tumor cells also maintain strong intercellular adhesion, and are growth-inhibited by cell- cell contact, especially when grown
Ali Rihani et al.
Cancer cell international, 15, 76-76 (2015-08-01)
Neuroblastoma is a neural crest-derived tumor and is the most common cancer in children less than 1 year of age. We hypothesized that aberrations in genes that control the cell cycle could play an important role in the pathogenesis of neuroblastoma
Wei Xing et al.
Journal of dermatological science, 79(2), 101-109 (2015-06-08)
Acemannan is a bioactive polysaccharides promoting tissue repair. However, the roles of acemannan in skin wound healing and the underlying molecular mechanisms are largely unclear. The goal of this study is to investigate the positive role of acemannan in cutaneous
Zhiping Li et al.
Cancer research, 74(14), 3959-3970 (2014-05-17)
The cyclin D1 gene encodes the regulatory subunit of a holoenyzme that phosphorylates the retinoblastoma protein (pRb) and nuclear respiratory factor (NRF1) proteins. The abundance of cyclin D1 determines estrogen-dependent gene expression in the mammary gland of mice. Using estradiol
Norihisa Bizen et al.
Stem cells (Dayton, Ohio), 32(6), 1602-1615 (2013-12-05)
Self-renewing proliferation of neural stem cells (NSCs) is intimately linked to the inhibition of neuronal and glial differentiation, however, their molecular linkage has been poorly understood. We have proposed a model previously explaining partly this linkage, in which fibroblast growth

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service