Skip to Content
Merck
CN

EMU043861

MISSION® esiRNA

targeting mouse Mmp2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAGAAGGCTGTGTTCTTCGCAGGGAATGAGTACTGGGTCTATTCTGCTAGTACTCTGGAGCGAGGATACCCCAAGCCACTGACCAGCCTGGGGTTGCCCCCTGATGTCCAGCAAGTAGATGCTGCCTTTAACTGGAGTAAGAACAAGAAGACATACATCTTTGCAGGAGACAAGTTCTGGAGATACAATGAAGTGAAGAAGAAAATGGACCCCGGTTTCCCTAAGCTCATCGCAGACTCCTGGAATGCCATCCCTGATAACCTGGATGCCGTCGTGGACCTGCAGGGTGGTGGTCATAGCTACTTCTTCAAGGGTGCTTATTACCTGAAGCTGGAGAACCAAAGTCTCAAGAGCGTGAAGTTTGGAAGCATCAAATCAGACTGGCTGGGCTGCTGAGCTGGCCCTGTTCCCACGGGCCCTATCATCTTCATCGCTGCACACCAGGTGAAGGATGTGAAGCAGCCTGGCGGCTCTGTCCTCCTCTGTAGTTAACCAGCCTTCTCCTTCACCTGGTGACTTCAGATTTAAGAGGGTGGCTTCTTTTTGTGCCCAAAG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yijing Chu et al.
Experimental cell research, 337(1), 16-27 (2015-07-26)
Adipose-derived mesenchymal stem cell (ADSC) is an important component of tumor microenvironment. However, whether ADSCs have a hand in ovarian cancer progression remains unclear. In this study, we investigated the impact of human ADSCs derived from the omentum of normal
Eric A Voll et al.
Oncotarget, 5(9), 2648-2663 (2014-05-07)
Prostate cancer (PCa) is the most common form of cancer in American men. Mortality from PCa is caused by the movement of cancer cells from the primary organ to form metastatic tumors at distant sites. Heat shock protein 27 (HSP27)
Irina Gradinaru et al.
PloS one, 10(11), e0142787-e0142787 (2015-11-17)
α1a Adrenergic receptors (α1aARs) are the predominant AR subtype in human vascular smooth muscle cells (SMCs). α1aARs in resistance vessels are crucial in the control of blood pressure, yet the impact of naturally occurring human α1aAR genetic variants in cardiovascular
Suping Yang et al.
Molecular medicine reports, 12(5), 6990-6996 (2015-09-10)
Prostate cancer (PCa) is the second leading cause of cancer‑related mortality among American males. Studies suggest that cigarette smoking is associated with the progression of PCa; however, the molecular mechanisms underlying this process have not been extensively investigated. PCa progression

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service