Merck
CN
All Photos(1)

Documents

Safety Information

EMU047641

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Brca1

Sign Into View Organizational & Contract Pricing
All Photos(1)
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGACTCCTTCCCAGGACAACTAGGTAGAAACAGAGGGCCTAAGGTGAACACTGTGCCTCCATTAGATAGTATGCAGCCTGGTGTCTGTCAGCAAAGTGTTCCTGTAAGTGATAAGTATCTTGAAATAAAAAAGCAGGAGGGTGAGGCTGTCTGTGCAGACTTCTCTCCATGTCTATTCTCAGACCATCTTGAGCAATCTATGAGTGGTAAGGTTTTTCAGGTTTGCTCTGAGACACCTGATGACCTGCTGGATGATGTTGAAATACAGGGACATACTAGCTTTGGTGAAGGTGACATAATGGAGAGATCTGCTGTCTTTAACGGAAGCATCCTGAGAAGGGAGTCCAGTAGGAGCCCTAGTCCTGTAACCCATGCATCGAAGTCTCAGAGTCTCCACAGAGCGTCTAGGAA

Ensembl | mouse accession no.

ENSMUSG00000017146

NCBI accession no.

NP_033894

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... BRCA1(12189) , Brca1(12189)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Oreekha Amin et al.
BMC cancer, 15, 817-817 (2015-10-30)
Impairment of homologous recombination (HR) is found in close to 50 % of ovarian and breast cancer. Tumors with BRCA1 mutations show increased expression of the Insulin-like growth factor type 1 receptor (IGF-1R). We previously have shown that inhibition of
Nadire Duru et al.
Cancer letters, 369(1), 184-191 (2015-08-25)
Breast and lung cancer patients who are treated with radiotherapy often have severe side effects, including radiation-induced lung damage and secondary cancers. Activation of the NRF2 pathway is a well-known mechanism that protects cells against radiation induced oxidative stress, but
Min Peng et al.
The EMBO journal, 33(15), 1698-1712 (2014-06-27)
Several proteins in the BRCA-Fanconi anemia (FA) pathway, such as FANCJ, BRCA1, and FANCD2, interact with mismatch repair (MMR) pathway factors, but the significance of this link remains unknown. Unlike the BRCA-FA pathway, the MMR pathway is not essential for
Samir Acharya et al.
PloS one, 9(8), e103819-e103819 (2014-08-02)
Fifteen percent of tumors utilize recombination-based alternative lengthening of telomeres (ALT) to maintain telomeres. The mechanisms underlying ALT are unclear but involve several proteins involved in homologous recombination including the BLM helicase, mutated in Bloom's syndrome, and the BRCA1 tumor
Monique G P van der Wijst et al.
Molecular oncology, 9(7), 1259-1273 (2015-04-07)
Risk factors indicate the importance of oxidative stress during ovarian carcinogenesis. To tolerate oxidative stress, cells activate the transcription factor Nrf2 (Nfe2l2), the master regulator of antioxidant and cytoprotective genes. Indeed, for most cancers, hyperactivity of Nrf2 is observed, and
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service