Skip to Content
Merck
CN

EMU048461

MISSION® esiRNA

targeting mouse Rictor

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGAAAGCAATCGCAACTCACCACAAGCGGGATCAGTATCTTCGAGTTCAGAAAGATATATTTGTTCTTAAGGATACAGAGGAAGCTCTTTTAATAAACCTTAGAGACAGCCAAGTCCTTCAGCATAAAGAGAATCTTGACTGGGATTGGAATCTGATTGGGACCATCCTTAAGTGGCCAAATGTAAATCTAAGAAACTATAAAGATGAGCAGTTGCACAGGTTTGTGCGCAGACTTCTTTACTTTTACAAGCCCAGCAGCAAACTGTACGCTAGTCTGGATCTGGACTTGGCCAAGTCCAAGCAGCTCACAGTTGTCGGTTGTCAGTTTACAGAATTTCTGCTCGAGTCTGAAGAGGATGGGCAAGGATACTTAGAAGATCTCGTGAAAGATATTGTTCAGTGGCTCAATGCTTCA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

12 - Non Combustible Liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品

This item has


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Haiying Cheng et al.
Cancer discovery, 5(12), 1262-1270 (2015-09-16)
We identified amplification of RICTOR, a key component of the mTOR complex 2 (mTORC2), as the sole actionable genomic alteration in an 18-year-old never-smoker with lung adenocarcinoma. Amplification of RICTOR occurs in 13% of lung cancers (1,016 cases) in The
Maikel A Farhan et al.
PloS one, 10(8), e0135245-e0135245 (2015-08-22)
Tumor neovascularization is targeted by inhibition of vascular endothelial growth factor (VEGF) or the receptor to prevent tumor growth, but drug resistance to angiogenesis inhibition limits clinical efficacy. Inhibition of the phosphoinositide 3 kinase pathway intermediate, mammalian target of rapamycin
Chi-Hao Chang et al.
Oncotarget, 6(3), 1478-1489 (2015-01-19)
Urothelial carcinoma is the most common type of malignancy in long-term dialysis patients and kidney transplant recipients in Taiwan. mTORCs (mammalian target of rapamycin complexes) and EGF are important in urothelial carcinoma. To identify the regulation of mTORCs upon EGF
Wenteh Chang et al.
PloS one, 9(8), e106155-e106155 (2014-08-28)
A characteristic of dysregulated wound healing in IPF is fibroblastic-mediated damage to lung epithelial cells within fibroblastic foci. In these foci, TGF-β and other growth factors activate fibroblasts that secrete growth factors and matrix regulatory proteins, which activate a fibrotic
Xiaohua Zhang et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(7), 5273-5281 (2015-02-11)
Recent studies have found that mammalian target of rapamycin complex 2 (mTORC2) is emerging as a potential therapeutic target in the treatment of many human cancers. However, the effects of targeting of mTORC2 on malignant pheochromocytomas (PCC) and paragangliomas (PGL)

Global Trade Item Number

SKUGTIN
EMU048461-50UG04061831369410
EMU048461-20UG04061831347623

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service